Transcription factor

H3BSL4 - E4F1

E4F transcription factor 1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 607 aa

9 Generated PWM 11 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)4

Motif	Prediction	Source	DNA binding	Support	Actions
M00952_2.00	NN 70-40%	CisBP	GGATGCTC	51.2% identity	Open · Scan
M07678_2.00	NN 70-40%	CisBP	CCCGCCCCCTCCTCCCCCTTCCCACCC	50.6% identity	Open · Scan
M00960_2.00	NN 70-40%	CisBP	TGCATCCC	50.0% identity	Open · Scan
MA0751.1	NN 70-40%	JASPAR	GACCCCCCGCTGTGC	50.0% identity	Open · Scan

ModCRE5

Motif	Prediction	Source	DNA binding	Support	Actions
TFS_tr_H3BSL4_H3BSL4_HUMAN:192:271_5ei9_E_1	ModCRE	Homology model	TCCCCCCCGGAGGCA	Region 192-271 · 1 3D model	Open · Scan
TFS_tr_H3BSL4_H3BSL4_HUMAN:194:269_5k5l_G_1	ModCRE	Homology model	GGGCCAAATTTGACGGT	Region 194-269 · 1 3D model	Open · Scan
TFS_tr_H3BSL4_H3BSL4_HUMAN:197:268_1a1g_A_1	ModCRE	Homology model	TTCCGCTGCG	Region 197-268 · 1 3D model	Open · Scan
TFS_tr_H3BSL4_H3BSL4_HUMAN:216:268_4gzn_C_1	ModCRE	Homology model	ATAGAGCCTT	Region 216-268 · 1 3D model	Open · Scan
TFS_tr_H3BSL4_H3BSL4_HUMAN:216:268_4m9v_C_1	ModCRE	Homology model	GTTGCAGCTT	Region 216-268 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 607 aa

191-422

Residues: 232 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 11 active PDBs · 6 summary rows
Templates: 1A1G, 1LLM, 4GZN, 4M9V, 5EH2, 5EI9, 5K5L, 5V3J, ...
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

11 active PDB models 6 summary rows

Region 191-42211 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	1llm	183:272	373,373	416,416	P:C,D · DNA:A,B	47.7% / 52.3%	50,51	View · PDB DIMER_tr_H3BSL4_H3BSL4_HUMAN:373:416_1llm_D_1
5	5eh2	183:272	192	271	P:F · DNA:C,D	42.5% / 56.2%	73	View · PDB TFS_tr_H3BSL4_H3BSL4_HUMAN:192:271_5eh2_F_1
1	5v3m	183:272	191	269	P:C · DNA:A,B	41.8% / 55.7%	28	View · PDB TFS_tr_H3BSL4_H3BSL4_HUMAN:191:269_5v3m_C_1
2	5v3j	183:272	191	269	P:E · DNA:A,B	41.8% / 55.7%	28	View · PDB TFS_tr_H3BSL4_H3BSL4_HUMAN:191:269_5v3j_E_1
3	5wjq	183:272	191	269	P:D · DNA:A,B	41.8% / 55.7%	28	View · PDB TFS_tr_H3BSL4_H3BSL4_HUMAN:191:269_5wjq_D_1
4	7w1m	183:272	194	422	P:H · DNA:F,G	28.1% / 43.8%	67	View · PDB TFS_tr_H3BSL4_H3BSL4_HUMAN:194:422_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
192-214	PF00096	Zinc finger, C2H2 type	overlaps 191-422
220-242	PF00096	Zinc finger, C2H2 type	overlaps 191-422
248-268	PF00096	Zinc finger, C2H2 type	overlaps 191-422
398-419	PF00096	Zinc finger, C2H2 type	overlaps 191-422