ModCRE DB

Transcription factor

H7BYU6 - ZNF521

Zinc finger protein 521

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1244 aa

10 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M02669_2.00 NN 70-40% CisBP GCACCCCTGGGTGCC 62.0% identity Open · Scan
M10151_2.00 NN 70-40% CisBP GCACCCTTGGGTGC 61.7% identity Open · Scan
MA0116.1 NN 70-40% JASPAR GGCACCCAGGGGTGC 58.5% identity Open · Scan
M00021_2.00 NN 70-40% CisBP TACCCCACAC 50.0% identity Open · Scan
M01397_2.00 NN 70-40% CisBP TGCGGAAT 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_tr_H7BYU6_H7BYU6_HUMAN:117:224_5ei9_E_1 ModCRE Homology model TTGGGGGGGGCCCGGTG Region 117-224 · 1 3D model Open · Scan
TFS_tr_H7BYU6_H7BYU6_HUMAN:117:228_2i13_A_1 ModCRE Homology model ATTTTCTAGCGCGCTCTCGGT Region 117-228 · 1 3D model Open · Scan
TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5v3j_E_1 ModCRE Homology model CGGTGCCTGCCCTTGCACGCAGGAGG Region 118-332 · 1 3D model Open · Scan
TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5v3m_C_1 ModCRE Homology model CGGCCGTGCGTGATATCGTCTTTCTC Region 118-332 · 1 3D model Open · Scan
TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5wjq_D_1 ModCRE Homology model GTGGGGCCCGCTAAGGTGGCCGGGGGG Region 118-332 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1244 aa
117-332

Region 117-332 5 PWM

Residues
216 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 5EI9, 5V3J, 5V3M, 5WJQ
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 117-3326 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_H7BYU6_H7BYU6_HUMAN:172:223_1llm_C_1 1llm 172-223 View model · PDB
Predicted = Low TFS_tr_H7BYU6_H7BYU6_HUMAN:117:224_5ei9_E_1 5ei9 117-224 View model · PDB
Predicted = Low TFS_tr_H7BYU6_H7BYU6_HUMAN:117:228_2i13_A_1 2i13 117-228 View model · PDB
Predicted = Low TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5v3j_E_1 5v3j 118-332 View model · PDB
Predicted = Low TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5v3m_C_1 5v3m 118-332 View model · PDB
Predicted = Low TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5wjq_D_1 5wjq 118-332 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 115:335 172,172 223,223 P:C,D · DNA:A,B 44.2% / 53.8% 59,61 View · PDB DIMER_tr_H7BYU6_H7BYU6_HUMAN:172:223_1llm_C_1
5 5ei9 115:335 117 224 P:E · DNA:A,B 40.7% / 55.6% 97 View · PDB TFS_tr_H7BYU6_H7BYU6_HUMAN:117:224_5ei9_E_1
4 2i13 115:335 117 228 P:A · DNA:C,D 40.2% / 56.2% 74 View · PDB TFS_tr_H7BYU6_H7BYU6_HUMAN:117:228_2i13_A_1
2 5v3m 115:335 118 332 P:C · DNA:A,B 29.1% / 46.3% 74 View · PDB TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5v3m_C_1
3 5v3j 115:335 118 332 P:E · DNA:A,B 29.1% / 46.3% 74 View · PDB TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5v3j_E_1
1 5wjq 115:335 118 332 P:D · DNA:A,B 28.6% / 45.8% 73 View · PDB TFS_tr_H7BYU6_H7BYU6_HUMAN:118:332_5wjq_D_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
46-67PF13912C2H2-type zinc fingerNo overlap with loaded model regions
118-140PF00096Zinc finger, C2H2 typeoverlaps 117-332
174-196PF00096Zinc finger, C2H2 typeoverlaps 117-332
312-334PF13912C2H2-type zinc fingeroverlaps 117-332
436-461PF13912C2H2-type zinc fingerNo overlap with loaded model regions
634-658PF13912C2H2-type zinc fingerNo overlap with loaded model regions
665-686PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
694-717PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
930-953PF13912C2H2-type zinc fingerNo overlap with loaded model regions
958-983PF13912C2H2-type zinc fingerNo overlap with loaded model regions
1139-1158PF12874Zinc-finger of C2H2 typeNo overlap with loaded model regions