ModCRE DB

Transcription factor

H7C414 - ZNF142

Zinc finger protein 142

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1065 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE6
MotifPredictionSourceDNA bindingSupportLogoActions
DIMER_tr_H7C414_H7C414_HUMAN:685:735_1llm_C_1 ModCRE Homology model ATTGCGCTAAAA Region 685-735 · 1 3D model Open · Scan
TFS_tr_H7C414_H7C414_HUMAN:543:735_8sss_A_1 ModCRE Homology model ACACCGTCGCGGCACTAGGGCAA Region 543-735 · 1 3D model Open · Scan
TFS_tr_H7C414_H7C414_HUMAN:543:735_8sst_A_1 ModCRE Homology model ACTACCCGCGGGCACGCGCCGAA Region 543-735 · 1 3D model Open · Scan
TFS_tr_H7C414_H7C414_HUMAN:543:800_7w1m_H_1 ModCRE Homology model ACCGCGGGGGGAATTACTCTCGCGTAGGCCCTTGGCCAGCAC Region 543-800 · 1 3D model Open · Scan
TFS_tr_H7C414_H7C414_HUMAN:593:730_2i13_A_1 ModCRE Homology model GGCCCTGCGGGGGCGGGGCCG Region 593-730 · 1 3D model Open · Scan
TFS_tr_H7C414_H7C414_HUMAN:601:800_8ssu_A_1 ModCRE Homology model GTCTTCCGGCGCGGCGCCT Region 601-800 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1065 aa
543-800

Region 543-800 6 PWM

Residues
258 aa
Domains
PF23574 · Zinc finger protein 142 C2H2 domain
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 7W1M, 8SSS, 8SST, 8SSU
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 543-8006 models · 6 summary rows
Actions
Predicted = Low DIMER_tr_H7C414_H7C414_HUMAN:685:735_1llm_C_1 1llm 685-735 View model · PDB
Predicted = Low TFS_tr_H7C414_H7C414_HUMAN:543:735_8sss_A_1 8sss 543-735 View model · PDB
Predicted = Low TFS_tr_H7C414_H7C414_HUMAN:543:735_8sst_A_1 8sst 543-735 View model · PDB
Predicted = Low TFS_tr_H7C414_H7C414_HUMAN:543:800_7w1m_H_1 7w1m 543-800 View model · PDB
Predicted = Low TFS_tr_H7C414_H7C414_HUMAN:593:730_2i13_A_1 2i13 593-730 View model · PDB
Predicted = Low TFS_tr_H7C414_H7C414_HUMAN:601:800_8ssu_A_1 8ssu 601-800 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
3 2i13 543:800 593 730 P:A · DNA:C,D 36.0% / 48.9% 89 View · PDB TFS_tr_H7C414_H7C414_HUMAN:593:730_2i13_A_1
1 1llm 543:800 685,685 735,735 P:C,D · DNA:A,B 32.7% / 48.1% 58,60 View · PDB DIMER_tr_H7C414_H7C414_HUMAN:685:735_1llm_C_1
2 8ssu 543:800 601 800 P:A · DNA:B,C 29.9% / 48.0% 84 View · PDB TFS_tr_H7C414_H7C414_HUMAN:601:800_8ssu_A_1
4 8sss 543:800 543 735 P:A · DNA:B,C 28.9% / 48.2% 96 View · PDB TFS_tr_H7C414_H7C414_HUMAN:543:735_8sss_A_1
5 8sst 543:800 543 735 P:A · DNA:B,C 28.9% / 48.2% 96 View · PDB TFS_tr_H7C414_H7C414_HUMAN:543:735_8sst_A_1
1 7w1m 543:800 543 800 P:H · DNA:F,G 27.9% / 45.0% 78 View · PDB TFS_tr_H7C414_H7C414_HUMAN:543:800_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
392-411PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
771-805PF23574Zinc finger protein 142 C2H2 domainoverlaps 543-800