ModCRE DB

Transcription factor

J3KPU9 - ZNF705A

Zinc finger protein 705A

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 207 aa

12 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M07763_2.00 NN 70+% CisBP AGAGGTTTCTT 94.6% identity Open · Scan
Nearest Neighbor (70% - 40%)11
MotifPredictionSourceDNA bindingSupportLogoActions
M07650_2.00 NN 70-40% CisBP GGTCTATAAAAGGGGGGCCGCGGGGGGG 62.1% identity Open · Scan
M06169_2.00 NN 70-40% CisBP GCCACGCCCAAC 57.6% identity Open · Scan
MA1594.1 NN 70-40% JASPAR AGGGGACATCACTACAGATCCCAC 56.6% identity Open · Scan
M08263_2.00 NN 70-40% CisBP ATCTCGGCACTTTGGGAGGCCA 54.2% identity Open · Scan
M04430_2.00 NN 70-40% CisBP GACCACGCCCA 53.8% identity Open · Scan
MA0599.1 NN 70-40% JASPAR GCCCCGCCCC 53.8% identity Open · Scan
MA0742.1 NN 70-40% JASPAR GACCACGCCCTTATT 53.8% identity Open · Scan
MA1516.1 NN 70-40% JASPAR GACCACGCCCA 53.8% identity Open · Scan
MA1517.1 NN 70-40% JASPAR GGCCACGCCCA 53.5% identity Open · Scan
M00134_2.00 NN 70-40% CisBP GCCACGCCCA 53.3% identity Open · Scan
M00641_2.00 NN 70-40% CisBP ATTGACCACT 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 207 aa
112-205

Region 112-205 0 PWM

Residues
94 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
5KKQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 112-2051 model
Actions
Predicted = Low TFS_J3KPU9:112:205_5kkq_A_1 5kkq 112-205 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
7-47PF01352KRAB boxNo overlap with loaded model regions