Transcription factor

J9JIC7 - VEZF1

Vascular endothelial zinc finger 1

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 340 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
MA1578.1	NN 70+%	JASPAR	CCCCCCACTT	98.2% identity		Open · Scan
M08864_2.00	NN 70+%	CisBP	CCTCCCCCCCCGCCCCCTCCCC	72.3% identity		Open · Scan

Nearest Neighbor (70% - 40%)6

Motif	Prediction	Source	DNA binding	Support	Actions
MA1522.1	NN 70-40%	JASPAR	CGCCCCTCCCC	64.8% identity	Open · Scan
M08870_2.00	NN 70-40%	CisBP	CCCCCCCCCCCCCCCCTCCCCC	58.3% identity	Open · Scan
M00019_2.00	NN 70-40%	CisBP	ACCCCTAATT	55.8% identity	Open · Scan
M01531_2.00	NN 70-40%	CisBP	CCCCCCCTAAAT	55.8% identity	Open · Scan
MA0753.1	NN 70-40%	JASPAR	CCCCCCCCAC	50.8% identity	Open · Scan
M08417_2.00	NN 70-40%	CisBP	TACCTA	50.0% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 340 aa

12-76

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 12-761 model

				Actions
Predicted = Low	TFS_J9JIC7:12:76_1p47_A_1	1p47	12-76	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
15-37	PF13894	C2H2-type zinc finger	overlaps 12-76
45-68	PF00096	Zinc finger, C2H2 type	overlaps 12-76