Transcription factor

J9JID5 - ZNF236

Zinc finger protein 236

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 1847 aa

22 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)18

Motif	Prediction	Source	DNA binding	Support	Actions
M07625_2.00	NN 70-40%	CisBP	TCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	65.3% identity	Open · Scan
M00944_2.00	NN 70-40%	CisBP	TCGCTATAA	56.4% identity	Open · Scan
M00953_2.00	NN 70-40%	CisBP	ATCTATAT	55.2% identity	Open · Scan
M00943_2.00	NN 70-40%	CisBP	CCCGCTGC	53.0% identity	Open · Scan
M00952_2.00	NN 70-40%	CisBP	GGATGCTC	53.0% identity	Open · Scan
M00960_2.00	NN 70-40%	CisBP	TGCATCCC	53.0% identity	Open · Scan
M01868_2.00	NN 70-40%	CisBP	TCTTGGCG	52.7% identity	Open · Scan
M00948_2.00	NN 70-40%	CisBP	GCAGCACC	51.8% identity	Open · Scan
M00959_2.00	NN 70-40%	CisBP	GCCCTCCC	51.8% identity	Open · Scan
M00958_2.00	NN 70-40%	CisBP	CGGCATCCC	51.7% identity	Open · Scan
M00950_2.00	NN 70-40%	CisBP	GCAGCCCA	50.6% identity	Open · Scan
M04430_2.00	NN 70-40%	CisBP	GACCACGCCCA	50.5% identity	Open · Scan
MA0742.1	NN 70-40%	JASPAR	GACCACGCCCTTATT	50.5% identity	Open · Scan
MA1516.1	NN 70-40%	JASPAR	GACCACGCCCA	50.5% identity	Open · Scan
M04505_2.00	NN 70-40%	CisBP	AGCTTTTCCCACAC	50.4% identity	Open · Scan
M04613_2.00	NN 70-40%	CisBP	CTCATGTGCTAATTACAAA	50.0% identity	Open · Scan
M06179_2.00	NN 70-40%	CisBP	TAAGCCTATAGA	50.0% identity	Open · Scan
MA0599.1	NN 70-40%	JASPAR	GCCCCGCCCC	50.0% identity	Open · Scan

ModCRE4

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_tr_J9JID5_J9JID5_HUMAN:537:586_1llm_C_1	ModCRE	Homology model	GCCGCGGCGGGG	Region 537-586 · 1 3D model	Open · Scan
TFS_tr_J9JID5_J9JID5_HUMAN:484:765_5v3j_E_1	ModCRE	Homology model	GGAAGATGGGACCCCCACAGGAAGTT	Region 484-765 · 1 3D model	Open · Scan
TFS_tr_J9JID5_J9JID5_HUMAN:484:765_5v3m_C_1	ModCRE	Homology model	GCGGGTGGTATTAGCTTAGGCGCGCC	Region 484-765 · 1 3D model	Open · Scan
TFS_tr_J9JID5_J9JID5_HUMAN:486:737_5wjq_D_1	ModCRE	Homology model	CTGTGTTAACCTTTGGTGGGCCGGCCCC	Region 486-737 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1847 aa

482-765

968-1245

Residues: 284 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 5 active PDBs · 5 summary rows
Templates: 1LLM, 5V3J, 5V3M, 5WJQ, 8SSR
Sources: Predicted = Low

Scan this region Show models

Residues: 278 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB · 1 summary row
Templates: 7W1M
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 482-7655 models · 5 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	1llm	443:765	537,537	586,586	P:C,D · DNA:A,B	52.0% / 66.0%	57,58	View · PDB DIMER_tr_J9JID5_J9JID5_HUMAN:537:586_1llm_C_1
1	5wjq	443:765	486	737	P:D · DNA:A,B	34.5% / 48.4%	87	View · PDB TFS_tr_J9JID5_J9JID5_HUMAN:486:737_5wjq_D_1
5	8ssr	443:765	482	733	P:A · DNA:B,C	32.8% / 47.1%	95	View · PDB TFS_tr_J9JID5_J9JID5_HUMAN:482:733_8ssr_A_1
2	5v3m	443:765	484	765	P:C · DNA:A,B	30.7% / 45.6%	98	View · PDB TFS_tr_J9JID5_J9JID5_HUMAN:484:765_5v3m_C_1
3	5v3j	443:765	484	765	P:E · DNA:A,B	30.7% / 45.6%	98	View · PDB TFS_tr_J9JID5_J9JID5_HUMAN:484:765_5v3j_E_1

Region 968-12451 model · 1 summary row

				Actions
Predicted = Low	TFS_tr_J9JID5_J9JID5_HUMAN:968:1245_7w1m_H_1	7w1m	968-1245	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
4	7w1m	443:765	968	1245	P:H · DNA:F,G	26.8% / 45.7%	86	View · PDB TFS_tr_J9JID5_J9JID5_HUMAN:968:1245_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
41-59	PF12874	Zinc-finger of C2H2 type	No overlap with loaded model regions
96-117	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
155-179	PF13912	C2H2-type zinc finger	No overlap with loaded model regions
199-221	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
227-249	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
287-310	PF13912	C2H2-type zinc finger	No overlap with loaded model regions
484-506	PF00096	Zinc finger, C2H2 type	overlaps 482-765
512-534	PF00096	Zinc finger, C2H2 type	overlaps 482-765
540-562	PF00096	Zinc finger, C2H2 type	overlaps 482-765
568-590	PF00096	Zinc finger, C2H2 type	overlaps 482-765
687-709	PF00096	Zinc finger, C2H2 type	overlaps 482-765
743-765	PF00096	Zinc finger, C2H2 type	overlaps 482-765
969-991	PF00096	Zinc finger, C2H2 type	overlaps 968-1245
997-1019	PF00096	Zinc finger, C2H2 type	overlaps 968-1245
1025-1047	PF00096	Zinc finger, C2H2 type	overlaps 968-1245
1184-1207	PF13465	Zinc-finger double domain	overlaps 968-1245
1225-1247	PF00096	Zinc finger, C2H2 type	overlaps 968-1245
1690-1710	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
1724-1746	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
1752-1774	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
1780-1803	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions