ModCRE DB

Transcription factor

K7EJF3 - ZNF763

Zinc finger protein 763

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 80 aa

25 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M07628_2.00 NN 70+% CisBP AGTGGTTCTGCTTCT 87.5% identity Open · Scan
M07627_2.00 NN 70+% CisBP CAGTCACCTTCTGG 78.7% identity Open · Scan
Nearest Neighbor (70% - 40%)23
MotifPredictionSourceDNA bindingSupportLogoActions
M07770_2.00 NN 70-40% CisBP CTTGGACTT 64.1% identity Open · Scan
MA1588.1 NN 70-40% JASPAR GAATTCTTGGTTGAC 61.6% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 60.0% identity Open · Scan
M03691_2.00 NN 70-40% CisBP ATGCAACAGGTGG 58.9% identity Open · Scan
M07731_2.00 NN 70-40% CisBP TTTCCCAGCAGCAACAGCACCGCCCCCCCC 57.6% identity Open · Scan
M03699_2.00 NN 70-40% CisBP CAACCACCTGTTAC 56.0% identity Open · Scan
M07659_2.00 NN 70-40% CisBP GTCTTCCAAGTAGCTGGTGTT 55.1% identity Open · Scan
M07717_2.00 NN 70-40% CisBP GGCTCCGCCCCC 54.0% identity Open · Scan
M07761_2.00 NN 70-40% CisBP CTGATTATTCACCCA 54.0% identity Open · Scan
M07600_2.00 NN 70-40% CisBP GCATTAGC 52.5% identity Open · Scan
M08311_2.00 NN 70-40% CisBP CTGGAACAGAAGGGGCGA 52.5% identity Open · Scan
M04610_2.00 NN 70-40% CisBP CGGCGACGCGAACAC 52.4% identity Open · Scan
M07699_2.00 NN 70-40% CisBP GGTTTAT 52.4% identity Open · Scan
M07700_2.00 NN 70-40% CisBP ATGTTGTGAGGAAGCCCA 52.4% identity Open · Scan
M06119_2.00 NN 70-40% CisBP TACCCTGTA 51.7% identity Open · Scan
M06087_2.00 NN 70-40% CisBP ACCACCTGTTGCA 51.2% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 50.8% identity Open · Scan
M07753_2.00 NN 70-40% CisBP TGCATTCCTTGGCTTGTG 50.8% identity Open · Scan
M08252_2.00 NN 70-40% CisBP CCGGCTCCAGCACCC 50.8% identity Open · Scan
M08375_2.00 NN 70-40% CisBP TTCCCCATTGGCTACTGCACCGGTCCT 50.8% identity Open · Scan
M08386_2.00 NN 70-40% CisBP GCCTTAAAAGCTCAGCAC 50.8% identity Open · Scan
M01444_2.00 NN 70-40% CisBP CACTGCCAC 50.0% identity Open · Scan
M07674_2.00 NN 70-40% CisBP AAATCCTTGACAATCAAGGGTTCCCTCAC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 80 aa
20-80

Region 20-80 0 PWM

Residues
61 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB
Templates
1G2D
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 20-801 model
Actions
Predicted = Low TFS_K7EJF3:20:80_1g2d_C_1 1g2d 20-80 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Imported domain tags5
Zn_Tnp_IS1595zf-C2H2zf-C2H2_6zf-C2H2_jazzf-H2C2_2