Transcription factor

K7EKZ8 - ZNF345

Zinc finger protein 345

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 184 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M04653_2.00	Known	CisBP	GGTACGGTTGTCCATGTTGCAA	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 184 aa

50-183

Residues: 134 aa
Domains: PF13465 · Zinc-finger double domain PF13465 · Zinc-finger double domain PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger
3D models: 1 active PDB
Templates: 5WJQ
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 50-1831 model

				Actions
Predicted = Low	TFS_K7EKZ8:50:183_5wjq_D_1	5wjq	50-183	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
77-100	PF13465	Zinc-finger double domain	overlaps 50-183
104-128	PF13465	Zinc-finger double domain	overlaps 50-183
146-168	PF00096	Zinc finger, C2H2 type	overlaps 50-183
174-184	PF13912	C2H2-type zinc finger	overlaps 50-183