Region 48-94 0 PWM
- Residues
- 47 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 1 active PDB
- Templates
- 6JNL
- Sources
- Structure model
Transcription factor
K7EM63 - ZNF345
Zinc finger protein 345
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 94 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M04653_2.00 | Known | CisBP | GGTACGGTTGTCCATGTTGCAA | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
94 aa
48-94
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 48-941 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_K7EM63:48:94_6jnl_A_1 | 6jnl | 48-94 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.