Region 281-390 0 PWM
- Residues
- 110 aa
- Domains
- PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
- 3D models
- 1 active PDB
- Templates
- 5EGB
- Sources
- Structure model
Transcription factor
K7EPW3 - ZNF875
Zinc finger protein 875
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 641 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07662_2.00 | Known | CisBP | CCTGTGTCCTCCCTGGTCCCC | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
641 aa
281-390
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 281-3901 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_K7EPW3:281:390_5egb_A_1 | 5egb | 281-390 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 14-53 | PF01352 | KRAB box | No overlap with loaded model regions |
| 96-113 | PF21225 | C2H2-type zinc finger | No overlap with loaded model regions |
| 283-305 | PF00096 | Zinc finger, C2H2 type | overlaps 281-390 |
| 311-333 | PF00096 | Zinc finger, C2H2 type | overlaps 281-390 |
| 339-361 | PF00096 | Zinc finger, C2H2 type | overlaps 281-390 |
| 367-389 | PF00096 | Zinc finger, C2H2 type | overlaps 281-390 |
| 395-417 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 423-445 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 451-473 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 479-501 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 507-529 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 535-557 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 589-611 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 617-639 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |