Region 50-65 0 PWM
- Residues
- 16 aa
- Domains
- PF18521 · Transactivation domain 2
- 3D models
- 1 active PDB
- Templates
- 4J19
- Sources
- Structure model
Transcription factor
K7PPU4 - TP53
Cellular tumor antigen p53
Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 393 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M11197_2.00 | Known | CisBP | AGACATGCCCGGGCATGTCC | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
393 aa
50-65
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 50-651 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_K7PPU4:50:65_4j19_B_1 | 4j19 | 50-65 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 6-30 | PF08563 | P53 transactivation motif | No overlap with loaded model regions |
| 35-59 | PF18521 | Transactivation domain 2 | overlaps 50-65 |
| 100-288 | PF00870 | P53 DNA-binding domain | No overlap with loaded model regions |
| 319-357 | PF07710 | P53 tetramerisation motif | No overlap with loaded model regions |