ModCRE DB

Transcription factor

M0QZ59 - ZNF304

Zinc finger protein 304

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 617 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07587_2.00 Known CisBP CCCCCTCCCCAGTCGAGCCCCCGC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 617 aa
236-397

Region 236-397 0 PWM

Residues
162 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 236-3971 model
Actions
Predicted = Low TFS_M0QZ59:236:397_5t0u_A_1 5t0u 236-397 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
237-259PF00096Zinc finger, C2H2 typeoverlaps 236-397
265-287PF00096Zinc finger, C2H2 typeoverlaps 236-397
293-315PF00096Zinc finger, C2H2 typeoverlaps 236-397
321-343PF00096Zinc finger, C2H2 typeoverlaps 236-397
349-371PF00096Zinc finger, C2H2 typeoverlaps 236-397
377-399PF00096Zinc finger, C2H2 typeoverlaps 236-397
433-455PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
461-483PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
489-511PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
517-539PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
545-567PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
573-595PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions