Transcription factor

M0R0A3 - ZNF584

Zinc finger protein 584

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 376 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M07631_2.00	Known	CisBP	AATTTCAAAAATGCTATGGGC	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 376 aa

169-299

Residues: 131 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13894 · C2H2-type zinc finger
3D models: 1 active PDB
Templates: 5T0U
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 169-2991 model

				Actions
Predicted = Low	TFS_M0R0A3:169:299_5t0u_A_1	5t0u	169-299	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
114-136	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
169-191	PF00096	Zinc finger, C2H2 type	overlaps 169-299
197-219	PF00096	Zinc finger, C2H2 type	overlaps 169-299
225-247	PF00096	Zinc finger, C2H2 type	overlaps 169-299
253-275	PF00096	Zinc finger, C2H2 type	overlaps 169-299
281-303	PF13894	C2H2-type zinc finger	overlaps 169-299
309-331	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
337-359	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions