Transcription factor

M0R202 - ZNF446

Zinc finger protein 446

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 399 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M00147_2.00	NN 70+%	CisBP	TGTGTGCAC	72.7% identity		Open · Scan

Nearest Neighbor (70% - 40%)7

Motif	Prediction	Source	DNA binding	Support	Actions
M07638_2.00	NN 70-40%	CisBP	TGCAGCTCCCTGCCC	60.9% identity	Open · Scan
MA1602.1	NN 70-40%	JASPAR	CGTCTACACGGG	58.8% identity	Open · Scan
M00764_2.00	NN 70-40%	CisBP	GTCTACAC	58.0% identity	Open · Scan
M07674_2.00	NN 70-40%	CisBP	AAATCCTTGACAATCAAGGGTTCCCTCAC	54.3% identity	Open · Scan
M07562_2.00	NN 70-40%	CisBP	GAAAAAAAC	52.4% identity	Open · Scan
M00769_2.00	NN 70-40%	CisBP	ACTCCCCC	52.3% identity	Open · Scan
M04611_2.00	NN 70-40%	CisBP	CTTTCGGACAC	50.5% identity	Open · Scan

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 399 aa

269-394

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 269-3941 model

				Actions
Predicted = Low	TFS_M0R202:269:394_2i13_A_1	2i13	269-394	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
22-109	PF02023	SCAN domain	No overlap with loaded model regions
209-238	PF01352	KRAB box	No overlap with loaded model regions
344-366	PF00096	Zinc finger, C2H2 type	overlaps 269-394