ModCRE DB

Transcription factor

O14896 - IRF6

Interferon regulatory factor 6 (IRF-6)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 467 aa

5 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known5
MotifPredictionSourceDNA bindingSupportLogoActions
MA1509.1 Known JASPAR ACCGAAACT Direct PWM Open · Scan
M05527_2.00 Known CisBP AGTTTCGGTAAAGCGATACT Direct PWM Open · Scan
M05528_2.00 Known CisBP AGTATCGGTTATGTGATACT Direct PWM Open · Scan
M05529_2.00 Known CisBP ACCGAAACT Direct PWM Open · Scan
M05530_2.00 Known CisBP ACCGATACC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 467 aa
9-112

Region 9-112 0 PWM

Residues
104 aa
Domains
PF00605 · Interferon regulatory factor transcription factor
3D models
1 active PDB
Templates
1T2K
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 9-1121 model
Actions
Predicted = Low DIMER_O14896:9:112_1t2k_A_1 1t2k 9-112 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
9-114PF00605Interferon regulatory factor transcription factoroverlaps 9-112
223-407PF10401Interferon-regulatory factor 3No overlap with loaded model regions