ModCRE DB

Transcription factor

O14901 - KLF11

Krueppel-like factor 11 (Transforming growth factor-beta-inducible early growth response protein 2) (TGFB-inducible early growth response protein 2) (TIEG-2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 512 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known6
MotifPredictionSourceDNA bindingSupportLogoActions
MA1512.1 Known JASPAR GCCACGCCCAC Direct PWM Open · Scan
MA1512.2 Known JASPAR CCACGCCCAC Direct PWM Open · Scan
M00241_2.00 Known CisBP CCGCCCCC Direct PWM Open · Scan
M00242_2.00 Known CisBP CCGCCCCC Direct PWM Open · Scan
M04554_2.00 Known CisBP GCCACGCCCACGCCACGCCCAC Direct PWM Open · Scan
M04555_2.00 Known CisBP GCCACGCCCCCGCCACGCCCAC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 512 aa
390-476

Region 390-476 0 PWM

Residues
87 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5KE9
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 390-4761 model
Actions
Predicted = Low TFS_O14901:390:476_5ke9_A_1 5ke9 390-476 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
394-418PF00096Zinc finger, C2H2 typeoverlaps 390-476
424-448PF00096Zinc finger, C2H2 typeoverlaps 390-476
454-476PF00096Zinc finger, C2H2 typeoverlaps 390-476