ModCRE DB

Transcription factor

O15060 - ZBTB39

Zinc finger and BTB domain-containing protein 39

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 712 aa

6 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)3
MotifPredictionSourceDNA bindingSupportLogoActions
M08540_2.00 NN 70-40% CisBP CCCCT 51.5% identity Open · Scan
M06119_2.00 NN 70-40% CisBP TACCCTGTA 50.9% identity Open · Scan
M00610_2.00 NN 70-40% CisBP AATTTAAAAA 50.0% identity Open · Scan
ModCRE3
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_O15060_ZBT39_HUMAN:452:683_5v3j_E_1 ModCRE Homology model TTTTCCTCCTCCAGGCCCACAAAGCC Region 452-683 · 1 3D model Open · Scan
TFS_sp_O15060_ZBT39_HUMAN:452:683_5v3m_C_1 ModCRE Homology model AAGGCCAGCTCCTCCACCTGTGCGGT Region 452-683 · 1 3D model Open · Scan
TFS_sp_O15060_ZBT39_HUMAN:452:683_5wjq_D_1 ModCRE Homology model ATAGGCTTACCGCCCCGCCCCGTTTTAG Region 452-683 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 712 aa
452-683

Region 452-683 3 PWM

Residues
232 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5V3J, 5V3M, 5WJQ, 8SSQ, 8SSR
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 452-6836 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_O15060_ZBT39_HUMAN:605:651_1llm_C_1 1llm 605-651 View model · PDB
Predicted = Low TFS_sp_O15060_ZBT39_HUMAN:452:679_8ssq_A_1 8ssq 452-679 View model · PDB
Predicted = Low TFS_sp_O15060_ZBT39_HUMAN:452:679_8ssr_A_1 8ssr 452-679 View model · PDB
Predicted = Low TFS_sp_O15060_ZBT39_HUMAN:452:683_5v3j_E_1 5v3j 452-683 View model · PDB
Predicted = Low TFS_sp_O15060_ZBT39_HUMAN:452:683_5v3m_C_1 5v3m 452-683 View model · PDB
Predicted = Low TFS_sp_O15060_ZBT39_HUMAN:452:683_5wjq_D_1 5wjq 452-683 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 452:688 605,605 651,651 P:C,D · DNA:A,B 34.0% / 53.2% 54,55 View · PDB DIMER_sp_O15060_ZBT39_HUMAN:605:651_1llm_C_1
1 5v3m 452:688 452 683 P:C · DNA:A,B 28.3% / 42.1% 78 View · PDB TFS_sp_O15060_ZBT39_HUMAN:452:683_5v3m_C_1
2 5v3j 452:688 452 683 P:E · DNA:A,B 28.3% / 42.1% 78 View · PDB TFS_sp_O15060_ZBT39_HUMAN:452:683_5v3j_E_1
3 5wjq 452:688 452 683 P:D · DNA:A,B 27.2% / 41.8% 77 View · PDB TFS_sp_O15060_ZBT39_HUMAN:452:683_5wjq_D_1
4 8ssr 452:688 452 679 P:A · DNA:B,C 24.1% / 36.8% 84 View · PDB TFS_sp_O15060_ZBT39_HUMAN:452:679_8ssr_A_1
5 8ssq 452:688 452 679 P:A · DNA:B,C 24.1% / 36.8% 84 View · PDB TFS_sp_O15060_ZBT39_HUMAN:452:679_8ssq_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
20-121PF00651BTB/POZ domainNo overlap with loaded model regions
508-530PF00096Zinc finger, C2H2 typeoverlaps 452-683
605-627PF00096Zinc finger, C2H2 typeoverlaps 452-683