Transcription factor

O15535 - ZSCAN9

Zinc finger and SCAN domain-containing protein 9 (Cell proliferation-inducing gene 12 protein) (PRD51) (Zinc finger protein 193)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 394 aa

2 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M04465_2.00	Known	CisBP	GTGATTCTTATCTTATCCTT	Direct PWM		Open · Scan
M04466_2.00	Known	CisBP	GTGATTCTTATCTTATCCTT	Direct PWM		Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 394 aa

250-389

Residues: 140 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 1 active PDB
Templates: 5V3J
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 250-3891 model

				Actions
Predicted = Low	TFS_O15535:250:389_5v3j_E_1	5v3j	250-389	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
49-136	PF02023	SCAN domain	No overlap with loaded model regions
254-276	PF00096	Zinc finger, C2H2 type	overlaps 250-389
282-304	PF00096	Zinc finger, C2H2 type	overlaps 250-389
310-332	PF00096	Zinc finger, C2H2 type	overlaps 250-389
338-360	PF00096	Zinc finger, C2H2 type	overlaps 250-389
366-388	PF00096	Zinc finger, C2H2 type	overlaps 250-389