ModCRE DB

Transcription factor

O43298 - ZBTB43

Zinc finger and BTB domain-containing protein 43 (Zinc finger and BTB domain-containing protein 22B) (Zinc finger protein 297B) (ZnF-x)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 467 aa

21 Generated PWM 11 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known2
MotifPredictionSourceDNA bindingSupportLogoActions
M04533_2.00 Known CisBP AGTGCCATAAAGGCAGCACT Direct PWM Open · Scan
M04534_2.00 Known CisBP AGTGCCATAAAGGCAGCACT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)11
MotifPredictionSourceDNA bindingSupportLogoActions
M07625_2.00 NN 70-40% CisBP TCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 54.3% identity Open · Scan
M07712_2.00 NN 70-40% CisBP ACATTTTTTTAATCTAAAAAAACATTTACA 53.0% identity Open · Scan
M07567_2.00 NN 70-40% CisBP CCACTCCACTCA 52.1% identity Open · Scan
M08917_2.00 NN 70-40% CisBP GCTGAGCCATGTGGGGTGCT 52.1% identity Open · Scan
MA1580.1 NN 70-40% JASPAR TGTACAGTAT 51.2% identity Open · Scan
M04475_2.00 NN 70-40% CisBP GATGCACGTACCGTGCCTCA 50.7% identity Open · Scan
M03583_2.00 NN 70-40% CisBP GGATGCTGTG 50.0% identity Open · Scan
M04568_2.00 NN 70-40% CisBP CGTGCCAACC 50.0% identity Open · Scan
M04611_2.00 NN 70-40% CisBP CTTTCGGACAC 50.0% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
MA0739.1 NN 70-40% JASPAR ATGCCAACC 50.0% identity Open · Scan
ModCRE8
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_O43298_ZBT43_HUMAN:352:447_7eyi_G_1 ModCRE Homology model ATCTGG Region 352-447 · 1 3D model Open · Scan
TFS_sp_O43298_ZBT43_HUMAN:352:447_7n5s_A_1 ModCRE Homology model TCCGGCCTGTGAA Region 352-447 · 1 3D model Open · Scan
TFS_sp_O43298_ZBT43_HUMAN:352:447_7n5t_A_1 ModCRE Homology model TGCGAAGCTAAAGA Region 352-447 · 1 3D model Open · Scan
TFS_sp_O43298_ZBT43_HUMAN:352:447_8e3d_A_1 ModCRE Homology model AAGCCCGAGTCCCCCGCCGGG Region 352-447 · 1 3D model Open · Scan
TFS_sp_O43298_ZBT43_HUMAN:352:447_8e3e_A_1 ModCRE Homology model AATCCGCGGGCCCCCCATGG Region 352-447 · 1 3D model Open · Scan
TFS_sp_O43298_ZBT43_HUMAN:377:428_5yj3_C_1 ModCRE Homology model GGAAA Region 377-428 · 1 3D model Open · Scan
TFS_sp_O43298_ZBT43_HUMAN:397:451_1f2i_G_1 ModCRE Homology model AACGGCCGCGA Region 397-451 · 1 3D model Open · Scan
TFS_sp_O43298_ZBT43_HUMAN:397:451_1f2i_H_1 ModCRE Homology model ACGCCGCCGTG Region 397-451 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 467 aa
352-453

Region 352-453 8 PWM

Residues
102 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
11 active PDBs · 8 summary rows
Templates
1F2I, 1HWT, 1LLM, 2HAP, 5YJ3, 7EYI, 7N5S, 7N5T, ...
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
11 active PDB models 8 summary rows
Region 352-45311 models · 8 summary rows
Actions
Predicted = Low DIMER_sp_O43298_ZBT43_HUMAN:397:446_1llm_D_1 1llm 397-446 View model · PDB
Predicted = Low DIMER_sp_O43298_ZBT43_HUMAN:427:453_1hwt_C_1 1hwt 427-453 View model · PDB
Predicted = Low DIMER_sp_O43298_ZBT43_HUMAN:427:453_2hap_C_1 2hap 427-453 View model · PDB
Predicted = Low TFS_sp_O43298_ZBT43_HUMAN:352:447_7eyi_G_1 7eyi 352-447 View model · PDB
Predicted = Low TFS_sp_O43298_ZBT43_HUMAN:352:447_7n5s_A_1 7n5s 352-447 View model · PDB
Predicted = Low TFS_sp_O43298_ZBT43_HUMAN:352:447_7n5t_A_1 7n5t 352-447 View model · PDB
Predicted = Low TFS_sp_O43298_ZBT43_HUMAN:352:447_8e3d_A_1 8e3d 352-447 View model · PDB
Predicted = Low TFS_sp_O43298_ZBT43_HUMAN:352:447_8e3e_A_1 8e3e 352-447 View model · PDB
Predicted = Low TFS_sp_O43298_ZBT43_HUMAN:377:428_5yj3_C_1 5yj3 377-428 View model · PDB
Predicted = Low TFS_sp_O43298_ZBT43_HUMAN:397:451_1f2i_G_1 1f2i 397-451 View model · PDB
Predicted = Low TFS_sp_O43298_ZBT43_HUMAN:397:451_1f2i_H_1 1f2i 397-451 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 1hwt 352:454 427,427 453,453 P:C,D · DNA:A,B 40.7% / 48.1% 38,36 View · PDB DIMER_sp_O43298_ZBT43_HUMAN:427:453_1hwt_C_1
3 2hap 352:454 427,427 453,453 P:C,D · DNA:A,B 40.7% / 48.1% 35,36 View · PDB DIMER_sp_O43298_ZBT43_HUMAN:427:453_2hap_C_1
1 1llm 352:454 397,397 446,446 P:C,D · DNA:A,B 38.0% / 60.0% 57,58 View · PDB DIMER_sp_O43298_ZBT43_HUMAN:397:446_1llm_D_1
1 8e3e 352:454 352 447 P:A · DNA:X,Y 35.1% / 53.6% 86 View · PDB TFS_sp_O43298_ZBT43_HUMAN:352:447_8e3e_A_1
2 8e3d 352:454 352 447 P:A · DNA:X,Y 35.1% / 53.6% 86 View · PDB TFS_sp_O43298_ZBT43_HUMAN:352:447_8e3d_A_1
3 7n5t 352:454 352 447 P:A · DNA:X,Y 35.1% / 53.6% 86 View · PDB TFS_sp_O43298_ZBT43_HUMAN:352:447_7n5t_A_1
4 7n5s 352:454 352 447 P:A · DNA:X,Y 35.1% / 53.6% 86 View · PDB TFS_sp_O43298_ZBT43_HUMAN:352:447_7n5s_A_1
5 7eyi 352:454 352 447 P:G · DNA:C,D 35.1% / 53.6% 86 View · PDB TFS_sp_O43298_ZBT43_HUMAN:352:447_7eyi_G_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
23-124PF00651BTB/POZ domainNo overlap with loaded model regions
402-422PF00096Zinc finger, C2H2 typeoverlaps 352-453