Transcription factor

O43435 - TBX1

T-box transcription factor TBX1 (T-box protein 1) (Testis-specific T-box protein)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 398 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known8

Motif	Prediction	Source	DNA binding	Support	Actions
MA0805.1	Known	JASPAR	AGGTGTGA	Direct PWM	Open · Scan
M03570_2.00	Known	CisBP	AGGTGTGAAAAAAGGTGTGA	Direct PWM	Open · Scan
M03571_2.00	Known	CisBP	AGGTGTGAAATTCACACCT	Direct PWM	Open · Scan
M03572_2.00	Known	CisBP	AGGTGTGA	Direct PWM	Open · Scan
M03573_2.00	Known	CisBP	TCTCACACCTCTGAGGTGTGAAA	Direct PWM	Open · Scan
M03574_2.00	Known	CisBP	TTCACACCTAGAGGTGTGAA	Direct PWM	Open · Scan
M05821_2.00	Known	CisBP	GAAGGTGTGAAA	Direct PWM	Open · Scan
M05822_2.00	Known	CisBP	GGAGGTGTGAAT	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 398 aa

109-296

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 109-2961 model

				Actions
Predicted = Low	DIMER_O43435:109:296_4s0h_E_1	4s0h	109-296	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
112-297	PF00907	T-box	overlaps 109-296