Transcription factor

O60281 - ZNF292

Zinc finger protein 292

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 2723 aa

7 Generated PWM 12 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE7

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_sp_O60281_ZN292_HUMAN:2028:2079_4ldx_A_1	ModCRE	Homology model	CCCCTTCACACTTCGAAGCGG	Region 2028-2079 · 1 3D model	Open · Scan
DIMER_sp_O60281_ZN292_HUMAN:724:752_1llm_C_1	ModCRE	Homology model	AAACCGCGCAAA	Region 724-752 · 1 3D model	Open · Scan
TFS_sp_O60281_ZN292_HUMAN:1900:1931_5ke6_A_1	ModCRE	Homology model	CACGACTGGA	Region 1900-1931 · 1 3D model	Open · Scan
TFS_sp_O60281_ZN292_HUMAN:1900:1931_5keb_A_1	ModCRE	Homology model	ACGAAGAGAA	Region 1900-1931 · 1 3D model	Open · Scan
TFS_sp_O60281_ZN292_HUMAN:1946:1972_2gli_A_1	ModCRE	Homology model	GGGGGGGCACTC	Region 1946-1972 · 1 3D model	Open · Scan
TFS_sp_O60281_ZN292_HUMAN:2256:2284_1tf3_A_1	ModCRE	Homology model	TTACTCTAAGGC	Region 2256-2284 · 1 3D model	Open · Scan
TFS_sp_O60281_ZN292_HUMAN:2256:2284_1tf6_A_1	ModCRE	Homology model	GTGGGGAAAGGT	Region 2256-2284 · 1 3D model	Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 2723 aa

720-832

1900-1931

1946-1972

2028-2079

2256-2284

Region 720-832 1 PWM

Residues: 113 aa
Domains: PF00096 · Zinc finger, C2H2 type
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 5EGB, 5EH2, 5EI9, 5KE6, 5T0U
Sources: Predicted = Low

Scan this region Show models

Region 1900-1931 2 PWM

Residues: 32 aa
Domains: No overlapping PFAM annotation recorded
3D models: 2 active PDBs
Templates: 5KE6, 5KEB
Sources: Predicted = Low

Scan this region Show models

Region 1946-1972 1 PWM

Residues: 27 aa
Domains: No overlapping PFAM annotation recorded
3D models: 1 active PDB
Templates: 2GLI
Sources: Predicted = Low

Scan this region Show models

Region 2028-2079 1 PWM

Residues: 52 aa
Domains: No overlapping PFAM annotation recorded
3D models: 1 active PDB
Templates: 4LDX
Sources: Predicted = Low

Scan this region Show models

Region 2256-2284 2 PWM

Residues: 29 aa
Domains: No overlapping PFAM annotation recorded
3D models: 2 active PDBs
Templates: 1TF3, 1TF6
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

12 active PDB models 6 summary rows

Region 720-8326 models · 6 summary rows

				Actions
Predicted = Low	DIMER_sp_O60281_ZN292_HUMAN:724:752_1llm_C_1	1llm	724-752	View model · PDB
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:720:832_5egb_A_1	5egb	720-832	View model · PDB
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:720:832_5ei9_E_1	5ei9	720-832	View model · PDB
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:723:832_5eh2_F_1	5eh2	723-832	View model · PDB
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:724:832_5t0u_A_1	5t0u	724-832	View model · PDB
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:727:804_5ke6_A_1	5ke6	727-804	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	1llm	680:832	724,724	752,752	P:C,D · DNA:A,B	41.4% / 58.6%	33,34	View · PDB DIMER_sp_O60281_ZN292_HUMAN:724:752_1llm_C_1
5	5ke6	680:832	727	804	P:A · DNA:B,C	33.3% / 44.9%	90	View · PDB TFS_sp_O60281_ZN292_HUMAN:727:804_5ke6_A_1
1	5ei9	680:832	720	832	P:E · DNA:A,B	29.2% / 46.9%	99	View · PDB TFS_sp_O60281_ZN292_HUMAN:720:832_5ei9_E_1
2	5egb	680:832	720	832	P:A · DNA:C,D	29.2% / 46.9%	99	View · PDB TFS_sp_O60281_ZN292_HUMAN:720:832_5egb_A_1
3	5eh2	680:832	723	832	P:F · DNA:C,D	29.1% / 47.3%	98	View · PDB TFS_sp_O60281_ZN292_HUMAN:723:832_5eh2_F_1
4	5t0u	680:832	724	832	P:A · DNA:B,C	27.5% / 40.4%	62	View · PDB TFS_sp_O60281_ZN292_HUMAN:724:832_5t0u_A_1

Region 1900-19312 models

				Actions
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:1900:1931_5ke6_A_1	5ke6	1900-1931	View model · PDB
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:1900:1931_5keb_A_1	5keb	1900-1931	View model · PDB

Region 1946-19721 model

				Actions
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:1946:1972_2gli_A_1	2gli	1946-1972	View model · PDB

Region 2028-20791 model

				Actions
Predicted = Low	DIMER_sp_O60281_ZN292_HUMAN:2028:2079_4ldx_A_1	4ldx	2028-2079	View model · PDB

Region 2256-22842 models

				Actions
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:2256:2284_1tf3_A_1	1tf3	2256-2284	View model · PDB
Predicted = Low	TFS_sp_O60281_ZN292_HUMAN:2256:2284_1tf6_A_1	1tf6	2256-2284	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
247-469	PF25580	Zinc finger protein Rlf-like, TPR repeats	No overlap with loaded model regions
531-563	PF25420	ZN292-like C2H2 zinc finger	No overlap with loaded model regions
807-831	PF00096	Zinc finger, C2H2 type	overlaps 720-832
2158-2212	PF26218	Zinc finger protein 292, C2H2-type zinc finger	No overlap with loaded model regions
2369-2426	PF26218	Zinc finger protein 292, C2H2-type zinc finger	No overlap with loaded model regions