Transcription factor

O60519 - CREBL2

cAMP-responsive element-binding protein-like 2

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 120 aa

3 Generated PWM 3 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE3

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_sp_O60519_CRBL2_HUMAN:27:73_5zko_C_1	ModCRE	Homology model	GTTTGCTCACGTGAGGAAAA	Region 27-73 · 1 3D model	Open · Scan
TFS_sp_O60519_CRBL2_HUMAN:27:73_5zko_A_1	ModCRE	Homology model	GGGTCACACGTCGAACATT	Region 27-73 · 1 3D model	Open · Scan
TFS_sp_O60519_CRBL2_HUMAN:27:73_5zko_C_1	ModCRE	Homology model	ACGTGTGGACGTGGGGCCCA	Region 27-73 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 120 aa

27-73

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

3 active PDB models 2 summary rows

Region 27-733 models · 2 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	5zko	27:73	27	73	P:C · DNA:B,D	38.3% / 59.6%	88	View · PDB TFS_sp_O60519_CRBL2_HUMAN:27:73_5zko_C_1
2	5zko	27:73	27	73	P:A · DNA:B,D	38.3% / 59.6%	88	View · PDB TFS_sp_O60519_CRBL2_HUMAN:27:73_5zko_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
26-75	PF07716	Basic region leucine zipper	overlaps 27-73