ModCRE DB

Transcription factor

O75290 - ZNF780A

Zinc finger protein 780A

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 641 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07729_2.00 Known CisBP CCAGACTGCCTGCCAAAACCCCCT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 641 aa
161-440

Region 161-440 0 PWM

Residues
280 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5WJQ
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 161-4401 model
Actions
Predicted = Low TFS_O75290:161:440_5wjq_D_1 5wjq 161-440 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
5-46PF01352KRAB boxNo overlap with loaded model regions
165-187PF00096Zinc finger, C2H2 typeoverlaps 161-440
193-215PF00096Zinc finger, C2H2 typeoverlaps 161-440
221-243PF00096Zinc finger, C2H2 typeoverlaps 161-440
249-271PF00096Zinc finger, C2H2 typeoverlaps 161-440
277-299PF00096Zinc finger, C2H2 typeoverlaps 161-440
333-355PF00096Zinc finger, C2H2 typeoverlaps 161-440
361-383PF00096Zinc finger, C2H2 typeoverlaps 161-440
389-411PF00096Zinc finger, C2H2 typeoverlaps 161-440
417-439PF00096Zinc finger, C2H2 typeoverlaps 161-440
473-495PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
501-523PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
529-551PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
557-579PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
585-607PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
613-635PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions