Transcription factor

O95231 - VENTX

Homeobox protein VENTX (VENT homeobox homolog) (VENT-like homeobox protein 2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 258 aa

10 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known10

Motif	Prediction	Source	DNA binding	Support	Actions
MA0724.1	Known	JASPAR	ACCGATTAG	Direct PWM	Open · Scan
M00303_2.00	Known	CisBP	GCTAATTACTG	Direct PWM	Open · Scan
M00304_2.00	Known	CisBP	AATATATAT	Direct PWM	Open · Scan
M00305_2.00	Known	CisBP	GTAATTAG	Direct PWM	Open · Scan
M02091_2.00	Known	CisBP	TTAATTAG	Direct PWM	Open · Scan
M03169_2.00	Known	CisBP	CTAATCGGT	Direct PWM	Open · Scan
M03170_2.00	Known	CisBP	CGCTAATCGGAAAACGATTAG	Direct PWM	Open · Scan
M05188_2.00	Known	CisBP	CGATAATCG	Direct PWM	Open · Scan
M05189_2.00	Known	CisBP	GCTAATTACC	Direct PWM	Open · Scan
M05190_2.00	Known	CisBP	GCTAATTACG	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 258 aa

93-148

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 93-1481 model

				Actions
Predicted = Low	DIMER_O95231:93:148_1hdd_D_1	1hdd	93-148	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
93-148	PF00046	Homeodomain	overlaps 93-148