ModCRE DB

Transcription factor

O95625 - ZBTB11

Zinc finger and BTB domain-containing protein 11

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1053 aa

7 Generated PWM 11 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
MA2329.1 Known JASPAR CACTTCCGG Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)1
MotifPredictionSourceDNA bindingSupportLogoActions
M06083_2.00 NN 70-40% CisBP CCCCCACCCCACAGTAACAAAAAC 56.2% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_O95625_ZBT11_HUMAN:648:757_2jp9_A_1 ModCRE Homology model CGGGGCCGGCCCCTAGG Region 648-757 · 1 3D model Open · Scan
TFS_sp_O95625_ZBT11_HUMAN:648:757_2jpa_A_1 ModCRE Homology model CGCCCCGCGCCCCT Region 648-757 · 1 3D model Open · Scan
TFS_sp_O95625_ZBT11_HUMAN:648:757_5egb_A_1 ModCRE Homology model AGATGAGCCACCCCTGGG Region 648-757 · 1 3D model Open · Scan
TFS_sp_O95625_ZBT11_HUMAN:648:757_5ei9_E_1 ModCRE Homology model AGGGGGTCCTGCCCAGT Region 648-757 · 1 3D model Open · Scan
TFS_sp_O95625_ZBT11_HUMAN:651:757_5eh2_F_1 ModCRE Homology model AGGGGGACCCCCCCCGGAT Region 651-757 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1053 aa
647-964

Region 647-964 5 PWM

Residues
318 aa
Domains
PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
11 active PDBs · 6 summary rows
Templates
1LLM, 2I13, 2JP9, 2JPA, 5EGB, 5EH2, 5EI9, 5V3J, ...
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
11 active PDB models 6 summary rows
Region 647-96411 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_O95625_ZBT11_HUMAN:705:753_1llm_D_1 1llm 705-753 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:647:932_5wjq_D_1 5wjq 647-932 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:648:757_2jp9_A_1 2jp9 648-757 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:648:757_2jpa_A_1 2jpa 648-757 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:648:757_5egb_A_1 5egb 648-757 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:648:757_5ei9_E_1 5ei9 648-757 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:651:757_5eh2_F_1 5eh2 651-757 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:651:964_7w1m_H_1 7w1m 651-964 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:653:932_5v3j_E_1 5v3j 653-932 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:653:932_5v3m_C_1 5v3m 653-932 View model · PDB
Predicted = Low TFS_sp_O95625_ZBT11_HUMAN:775:932_2i13_A_1 2i13 775-932 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
4 2i13 625:964 775 932 P:A · DNA:C,D 37.3% / 54.4% 97 View · PDB TFS_sp_O95625_ZBT11_HUMAN:775:932_2i13_A_1
1 1llm 625:964 705,705 753,753 P:C,D · DNA:A,B 36.7% / 55.1% 56,57 View · PDB DIMER_sp_O95625_ZBT11_HUMAN:705:753_1llm_D_1
1 5v3m 625:964 653 932 P:C · DNA:A,B 34.3% / 46.4% 97 View · PDB TFS_sp_O95625_ZBT11_HUMAN:653:932_5v3m_C_1
2 5v3j 625:964 653 932 P:E · DNA:A,B 34.3% / 46.4% 97 View · PDB TFS_sp_O95625_ZBT11_HUMAN:653:932_5v3j_E_1
3 5wjq 625:964 647 932 P:D · DNA:A,B 31.1% / 47.6% 97 View · PDB TFS_sp_O95625_ZBT11_HUMAN:647:932_5wjq_D_1
5 7w1m 625:964 651 964 P:H · DNA:F,G 28.0% / 43.7% 94 View · PDB TFS_sp_O95625_ZBT11_HUMAN:651:964_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
68-121PF17921Integrase zinc binding domainNo overlap with loaded model regions
204-306PF00651BTB/POZ domainNo overlap with loaded model regions
569-593PF13912C2H2-type zinc fingerNo overlap with loaded model regions
597-620PF13912C2H2-type zinc fingerNo overlap with loaded model regions
651-673PF13912C2H2-type zinc fingeroverlaps 647-964
679-701PF00096Zinc finger, C2H2 typeoverlaps 647-964
707-729PF00096Zinc finger, C2H2 typeoverlaps 647-964
735-759PF13912C2H2-type zinc fingeroverlaps 647-964
766-788PF00096Zinc finger, C2H2 typeoverlaps 647-964
822-846PF00096Zinc finger, C2H2 typeoverlaps 647-964
859-880PF00096Zinc finger, C2H2 typeoverlaps 647-964
914-937PF00096Zinc finger, C2H2 typeoverlaps 647-964