Transcription factor

O95936 - EOMES

Eomesodermin homolog (T-box brain protein 2) (T-brain-2) (TBR-2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 686 aa

8 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known8

Motif	Prediction	Source	DNA binding	Support	Actions
MA0800.1	Known	JASPAR	AAGGTGTGAAAAT	Direct PWM	Open · Scan
MA0800.2	Known	JASPAR	AGGTGTGAA	Direct PWM	Open · Scan
M02752_2.00	Known	CisBP	AGGTGTGAA	Direct PWM	Open · Scan
M03563_2.00	Known	CisBP	AAGGTGTGAAAAT	Direct PWM	Open · Scan
M03564_2.00	Known	CisBP	TCACACCTTCTAAGGTGTGA	Direct PWM	Open · Scan
M05807_2.00	Known	CisBP	GAGGTGTGAA	Direct PWM	Open · Scan
M05808_2.00	Known	CisBP	AAGGTGTGAA	Direct PWM	Open · Scan
M09647_2.00	Known	CisBP	AGGTGTTAAT	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 686 aa

269-455

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 269-4551 model

				Actions
Predicted = Low	DIMER_O95936:269:455_4s0h_E_1	4s0h	269-455	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
270-456	PF00907	T-box	overlaps 269-455
463-684	PF16176	T-box transcription factor-associated	No overlap with loaded model regions