ModCRE DB

Transcription factor

O96004 - HAND1

Heart- and neural crest derivatives-expressed protein 1 (Class A basic helix-loop-helix protein 27) (bHLHa27) (Extraembryonic tissues, heart, autonomic nervous system and neural crest derivatives-expressed protein 1) (eHAND)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 215 aa

18 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
MA2123.1 Known JASPAR TCCAGACCT Direct PWM Open · Scan
Nearest Neighbor (>70%)1
MotifPredictionSourceDNA bindingSupportLogoActions
MA0092.1 NN 70+% JASPAR GGTCTGGCAT 92.1% identity Open · Scan
Nearest Neighbor (70% - 40%)16
MotifPredictionSourceDNA bindingSupportLogoActions
M00756_2.00 NN 70-40% CisBP CGCAGCTGTG 59.1% identity Open · Scan
MA0048.1 NN 70-40% JASPAR GCGCAGCTGCGT 59.1% identity Open · Scan
MA1529.1 NN 70-40% JASPAR GGGCCGCAGCTGCGTCCC 59.1% identity Open · Scan
MA0607.1 NN 70-40% JASPAR CCATATGT 57.7% identity Open · Scan
MA1472.1 NN 70-40% JASPAR AACAGCTGTT 57.7% identity Open · Scan
M01718_2.00 NN 70-40% CisBP AACATATGGT 57.6% identity Open · Scan
MA0633.1 NN 70-40% JASPAR ACCATATGTT 57.6% identity Open · Scan
MA1123.1 NN 70-40% JASPAR ATTCCAGATGTTT 57.6% identity Open · Scan
M03606_2.00 NN 70-40% CisBP CCACACGACGCA 54.0% identity Open · Scan
MA0832.1 NN 70-40% JASPAR GCAACAGCTGTTGT 53.8% identity Open · Scan
MA1568.1 NN 70-40% JASPAR CACCATATGGCG 53.8% identity Open · Scan
MA0665.1 NN 70-40% JASPAR AACAGCTGTT 51.9% identity Open · Scan
MA1638.1 NN 70-40% JASPAR ACCAGATGGC 51.6% identity Open · Scan
M06000_2.00 NN 70-40% CisBP CCAGATGGCACGGACACAACA 51.0% identity Open · Scan
M04156_2.00 NN 70-40% CisBP AACAGCTGACGC 50.0% identity Open · Scan
MA1618.1 NN 70-40% JASPAR AAACAGATGTTTA 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 215 aa
103-143

Region 103-143 0 PWM

Residues
41 aa
Domains
PF00010 · Helix-loop-helix DNA-binding domain
3D models
1 active PDB
Templates
5I50
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 103-1431 model
Actions
Predicted = Low DIMER_O96004:103:143_5i50_B_1 5i50 103-143 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
97-146PF00010Helix-loop-helix DNA-binding domainoverlaps 103-143