ModCRE DB

Transcription factor

P06400 - RB1

Retinoblastoma-associated protein (p105-Rb) (p110-RB1) (pRb) (Rb) (pp110)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 928 aa

5 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_P06400_RB_HUMAN:60:105_4roc_A_1 ModCRE Homology model AAAAAGCTTTTACCTTTTTT Region 60-105 · 1 3D model Open · Scan
TFS_sp_P06400_RB_HUMAN:60:105_4rod_A_1 ModCRE Homology model TAAAATTTTTTGGCCATAAA Region 60-105 · 1 3D model Open · Scan
TFS_sp_P06400_RB_HUMAN:60:105_5n9g_A_1 ModCRE Homology model TCAAGTTTTAAACAAATA Region 60-105 · 1 3D model Open · Scan
TFS_sp_P06400_RB_HUMAN:60:105_8ity_V_1 ModCRE Homology model ATAAAAAGTTTTTGCCAAAA Region 60-105 · 1 3D model Open · Scan
TFS_sp_P06400_RB_HUMAN:60:105_8iue_V_1 ModCRE Homology model ACAACAGCTTTCCAAAAA Region 60-105 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 928 aa
60-105

Region 60-105 5 PWM

Residues
46 aa
Domains
No overlapping PFAM annotation recorded
3D models
5 active PDBs · 4 summary rows
Templates
4ROC, 4ROD, 5N9G, 8ITY, 8IUE
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 4 summary rows
Region 60-1055 models · 4 summary rows
Actions
Predicted = Low TFS_sp_P06400_RB_HUMAN:60:105_4roc_A_1 4roc 60-105 View model · PDB
Predicted = Low TFS_sp_P06400_RB_HUMAN:60:105_4rod_A_1 4rod 60-105 View model · PDB
Predicted = Low TFS_sp_P06400_RB_HUMAN:60:105_5n9g_A_1 5n9g 60-105 View model · PDB
Predicted = Low TFS_sp_P06400_RB_HUMAN:60:105_8ity_V_1 8ity 60-105 View model · PDB
Predicted = Low TFS_sp_P06400_RB_HUMAN:60:105_8iue_V_1 8iue 60-105 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 8iue 60:105 60 105 P:V · DNA:X,Y 28.3% / 52.2% 12 View · PDB TFS_sp_P06400_RB_HUMAN:60:105_8iue_V_1
2 8ity 60:105 60 105 P:V · DNA:X,Y 28.3% / 52.2% 12 View · PDB TFS_sp_P06400_RB_HUMAN:60:105_8ity_V_1
3 4roc 60:105 60 105 P:A · DNA:N,T 28.3% / 52.2% 15 View · PDB TFS_sp_P06400_RB_HUMAN:60:105_4roc_A_1
4 4rod 60:105 60 105 P:A · DNA:N,T 28.3% / 52.2% 15 View · PDB TFS_sp_P06400_RB_HUMAN:60:105_4rod_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
113-226PF11934Domain of unknown function (DUF3452)No overlap with loaded model regions
373-573PF01858Retinoblastoma-associated protein A domainNo overlap with loaded model regions
646-765PF01857Retinoblastoma-associated protein B domainNo overlap with loaded model regions
768-925PF08934Rb C-terminal domainNo overlap with loaded model regions