ModCRE DB

Transcription factor

P0CB47 - UBTFL1

Upstream-binding factor 1-like protein 1

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 393 aa

9 Generated PWM 10 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE9
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_P0CB47_UBFL1_HUMAN:100:194_3tmm_A_1 ModCRE Homology model ACCGGGGACCCCCGGCGCTATTAGCCCG Region 100-194 · 1 3D model Open · Scan
TFS_sp_P0CB47_UBFL1_HUMAN:100:194_4nnu_B_1 ModCRE Homology model AAGTTCCGTTAGGCTCCTTATA Region 100-194 · 1 3D model Open · Scan
TFS_sp_P0CB47_UBFL1_HUMAN:100:194_4nod_A_1 ModCRE Homology model TCTAGGGGGGACCGGGACGGCG Region 100-194 · 1 3D model Open · Scan
TFS_sp_P0CB47_UBFL1_HUMAN:100:194_6hc3_A_1 ModCRE Homology model TAAAAAAAGTCGTAAGTGACT Region 100-194 · 1 3D model Open · Scan
TFS_sp_P0CB47_UBFL1_HUMAN:100:194_7lbx_A_1 ModCRE Homology model CCCCGCCCCCAAAAAAAAAAAA Region 100-194 · 1 3D model Open · Scan
TFS_sp_P0CB47_UBFL1_HUMAN:100:194_7lbx_B_1 ModCRE Homology model GAGTTAATCTTGACGCTATTTG Region 100-194 · 1 3D model Open · Scan
TFS_sp_P0CB47_UBFL1_HUMAN:98:167_1qrv_A_1 ModCRE Homology model AGAAAATTA Region 98-167 · 1 3D model Open · Scan
TFS_sp_P0CB47_UBFL1_HUMAN:98:167_3nm9_G_1 ModCRE Homology model TCCCCAAAACGATCGGCCGCTC Region 98-167 · 1 3D model Open · Scan
TFS_sp_P0CB47_UBFL1_HUMAN:98:167_3nm9_J_1 ModCRE Homology model TTTGGCCCACCCCCGATAGA Region 98-167 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 393 aa
98-194

Region 98-194 9 PWM

Residues
97 aa
Domains
PF00505 · HMG (high mobility group) box
3D models
10 active PDBs · 5 summary rows
Templates
1QRV, 3NM9, 3TMM, 4NNU, 4NOD, 6HC3, 7LBX
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
10 active PDB models 5 summary rows
Region 98-19410 models · 5 summary rows
Actions
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:100:194_3tmm_A_1 3tmm 100-194 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:100:194_4nnu_A_1 4nnu 100-194 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:100:194_4nnu_B_1 4nnu 100-194 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:100:194_4nod_A_1 4nod 100-194 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:100:194_6hc3_A_1 6hc3 100-194 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:100:194_7lbx_A_1 7lbx 100-194 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:100:194_7lbx_B_1 7lbx 100-194 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:98:167_1qrv_A_1 1qrv 98-167 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:98:167_3nm9_G_1 3nm9 98-167 View model · PDB
Predicted = Low TFS_sp_P0CB47_UBFL1_HUMAN:98:167_3nm9_J_1 3nm9 98-167 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6hc3 86:194 100 194 P:A · DNA:B,C 31.2% / 59.4% 49 View · PDB TFS_sp_P0CB47_UBFL1_HUMAN:100:194_6hc3_A_1
2 3tmm 86:194 100 194 P:A · DNA:B,C 31.2% / 59.4% 48 View · PDB TFS_sp_P0CB47_UBFL1_HUMAN:100:194_3tmm_A_1
3 7lbx 86:194 100 194 P:B · DNA:C,D,E,F 31.2% / 59.4% 50 View · PDB TFS_sp_P0CB47_UBFL1_HUMAN:100:194_7lbx_B_1
4 4nnu 86:194 100 194 P:B · DNA:C,D,E,F 31.2% / 59.4% 49 View · PDB TFS_sp_P0CB47_UBFL1_HUMAN:100:194_4nnu_B_1
5 7lbx 86:194 100 194 P:A · DNA:C,D,E,F 31.2% / 59.4% 50 View · PDB TFS_sp_P0CB47_UBFL1_HUMAN:100:194_7lbx_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
100-167PF00505HMG (high mobility group) boxoverlaps 98-194