Transcription factor

P15036 - ETS2

Protein C-ets-2

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 469 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known6

Motif	Prediction	Source	DNA binding	Support	Actions
MA1484.1	Known	JASPAR	GACCGGAAGT	Direct PWM	Open · Scan
MA1484.2	Known	JASPAR	ACCGGAAGT	Direct PWM	Open · Scan
M04778_2.00	Known	CisBP	GACCGGAAGTACTTCCGGTC	Direct PWM	Open · Scan
M04779_2.00	Known	CisBP	AACAGGAAGTACTTCCTGTT	Direct PWM	Open · Scan
M09058_2.00	Known	CisBP	GGAAGGAAGAGGA	Direct PWM	Open · Scan
ETS2_HUMAN.H11MO.0.B	Known	HOCOMOCO	GGAAGGAAGAGGA	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 469 aa

330-465

Residues: 136 aa
Domains: PF19525 · Ets1 N-terminal flanking region of Ets domain PF00178 · Ets-domain
3D models: 1 active PDB
Templates: 3RI4
Sources: Structure model

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 330-4651 model

				Actions
Predicted = Low	DIMER_P15036:330:465_3ri4_D_1	3ri4	330-465	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
88-169	PF02198	Sterile alpha motif (SAM)/Pointed domain	No overlap with loaded model regions
274-359	PF19525	Ets1 N-terminal flanking region of Ets domain	overlaps 330-465
363-443	PF00178	Ets-domain	overlaps 330-465