ModCRE DB

Transcription factor

P17039 - ZNF30

Zinc finger protein 30 (Zinc finger protein KOX28)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 623 aa

2 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known2
MotifPredictionSourceDNA bindingSupportLogoActions
M08330_2.00 Known CisBP TGGGTGCCGGACTGCTGTTCC Direct PWM Open · Scan
M07621_2.00 Known CisBP CAGCCGCCCCGTCCG Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 623 aa
232-392

Region 232-392 0 PWM

Residues
161 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 232-3921 model
Actions
Predicted = Low TFS_P17039:232:392_5t0u_A_1 5t0u 232-392 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
13-54PF01352KRAB boxNo overlap with loaded model regions
149-170PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
205-226PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
232-254PF00096Zinc finger, C2H2 typeoverlaps 232-392
262-282PF00096Zinc finger, C2H2 typeoverlaps 232-392
288-310PF00096Zinc finger, C2H2 typeoverlaps 232-392
316-338PF00096Zinc finger, C2H2 typeoverlaps 232-392
344-366PF00096Zinc finger, C2H2 typeoverlaps 232-392
374-394PF00096Zinc finger, C2H2 typeoverlaps 232-392
400-422PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
428-450PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
456-478PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
484-506PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
512-534PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
540-562PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
568-590PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
596-618PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions