Region 247-357 0 PWM
- Residues
- 111 aa
- Domains
- PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
- 3D models
- 1 active PDB
- Templates
- 5EGB
- Sources
- Structure model
Transcription factor
P17097 - ZNF7
Zinc finger protein 7 (Zinc finger protein HF.16) (Zinc finger protein KOX4)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 686 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07598_2.00 | Known | CisBP | CTGACAATACCAAGTGTTGAC | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
686 aa
247-357
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 247-3571 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_P17097:247:357_5egb_A_1 | 5egb | 247-357 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 4-41 | PF01352 | KRAB box | No overlap with loaded model regions |
| 250-272 | PF00096 | Zinc finger, C2H2 type | overlaps 247-357 |
| 278-300 | PF00096 | Zinc finger, C2H2 type | overlaps 247-357 |
| 306-328 | PF00096 | Zinc finger, C2H2 type | overlaps 247-357 |
| 336-356 | PF00096 | Zinc finger, C2H2 type | overlaps 247-357 |
| 362-384 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 469-491 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 497-519 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 525-547 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 553-575 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 581-603 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 634-656 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |
| 662-684 | PF00096 | Zinc finger, C2H2 type | No overlap with loaded model regions |