ModCRE DB

Transcription factor

P17097 - ZNF7

Zinc finger protein 7 (Zinc finger protein HF.16) (Zinc finger protein KOX4)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 686 aa

1 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known1
MotifPredictionSourceDNA bindingSupportLogoActions
M07598_2.00 Known CisBP CTGACAATACCAAGTGTTGAC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 686 aa
247-357

Region 247-357 0 PWM

Residues
111 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5EGB
Sources
Structure model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 247-3571 model
Actions
Predicted = Low TFS_P17097:247:357_5egb_A_1 5egb 247-357 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
4-41PF01352KRAB boxNo overlap with loaded model regions
250-272PF00096Zinc finger, C2H2 typeoverlaps 247-357
278-300PF00096Zinc finger, C2H2 typeoverlaps 247-357
306-328PF00096Zinc finger, C2H2 typeoverlaps 247-357
336-356PF00096Zinc finger, C2H2 typeoverlaps 247-357
362-384PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
469-491PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
497-519PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
525-547PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
553-575PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
581-603PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
634-656PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
662-684PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions