ModCRE DB

Transcription factor

P17861 - XBP1

X-box-binding protein 1 (XBP-1) (Tax-responsive element-binding protein 5) (TREB-5) [Cleaved into: X-box-binding protein 1, cytoplasmic form; X-box-binding protein 1, luminal form]

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 261 aa

14 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known14
MotifPredictionSourceDNA bindingSupportLogoActions
MA0844.1 Known JASPAR AATGCCACGTCATC Direct PWM Open · Scan
MA0844.2 Known JASPAR GCCACGTCATC Direct PWM Open · Scan
M02730_2.00 Known CisBP GACGTGGCATT Direct PWM Open · Scan
M02825_2.00 Known CisBP GATGACGTCATC Direct PWM Open · Scan
M02826_2.00 Known CisBP GATGACGTGGCATT Direct PWM Open · Scan
M04010_2.00 Known CisBP GATGACGTGGCA Direct PWM Open · Scan
M04011_2.00 Known CisBP GATGACGTCATC Direct PWM Open · Scan
M04012_2.00 Known CisBP TGCCACGTGTACA Direct PWM Open · Scan
M04231_2.00 Known CisBP GGTGACGTGGCC Direct PWM Open · Scan
M04232_2.00 Known CisBP GGTGACGTCATC Direct PWM Open · Scan
M04233_2.00 Known CisBP CGCCACGTCACC Direct PWM Open · Scan
M04234_2.00 Known CisBP GATGACGTCATC Direct PWM Open · Scan
M09932_2.00 Known CisBP CAGAAAGATGACGTGTCATTTAAT Direct PWM Open · Scan
M09933_2.00 Known CisBP ATGATGACGTGTCCTAT Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 261 aa
72-120

Region 72-120 0 PWM

Residues
49 aa
Domains
PF07716 · Basic region leucine zipper
3D models
1 active PDB
Templates
3A5T
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 72-1201 model
Actions
Predicted = Low DIMER_P17861:72:120_3a5t_A_1 3a5t 72-120 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
69-120PF07716Basic region leucine zipperoverlaps 72-120