Transcription factor

P20393 - NR1D1

Nuclear receptor subfamily 1 group D member 1 (Rev-erbA-alpha) (V-erbA-related protein 1) (EAR-1)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 614 aa

6 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known6

Motif	Prediction	Source	DNA binding	Support	Actions
MA1531.1	Known	JASPAR	GGGTCAGTAGGTCAG	Direct PWM	Open · Scan
MA1531.2	Known	JASPAR	GGGTCAGTAGGTCA	Direct PWM	Open · Scan
M05605_2.00	Known	CisBP	GATGTGGGTCAGTAGGTCAG	Direct PWM	Open · Scan
M05606_2.00	Known	CisBP	GATGTGGGTCAGTAGGTCAG	Direct PWM	Open · Scan
M09276_2.00	Known	CisBP	AGGGAAGTGGGTCAGAAGG	Direct PWM	Open · Scan
NR1D1_HUMAN.H11MO.0.B	Known	HOCOMOCO	AGGGAAGTGGGTCAGAAGG	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 614 aa

127-210

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 127-2101 model

				Actions
Predicted = Low	DIMER_P20393:127:210_1a6y_B_1	1a6y	127-210	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
131-200	PF00105	Double treble clef zinc finger, C4 type	overlaps 127-210
437-611	PF00104	Ligand-binding domain of nuclear hormone receptor	No overlap with loaded model regions