Transcription factor

P20719 - HOXA5

Homeobox protein Hox-A5 (Homeobox protein Hox-1C)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 270 aa

10 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known10

Motif	Prediction	Source	DNA binding	Support	Actions
MA0158.1	Known	JASPAR	CACTAATT	Direct PWM	Open · Scan
MA0158.2	Known	JASPAR	GTAATTAC	Direct PWM	Open · Scan
M04968_2.00	Known	CisBP	GTAATTAC	Direct PWM	Open · Scan
M04969_2.00	Known	CisBP	CTAATTAC	Direct PWM	Open · Scan
M04970_2.00	Known	CisBP	TTAATGAC	Direct PWM	Open · Scan
M04971_2.00	Known	CisBP	GTAATTAC	Direct PWM	Open · Scan
M04972_2.00	Known	CisBP	GTAATTAC	Direct PWM	Open · Scan
M04973_2.00	Known	CisBP	TTAATGAT	Direct PWM	Open · Scan
M08457_2.00	Known	CisBP	CACTAATT	Direct PWM	Open · Scan
M10652_2.00	Known	CisBP	TGGAGGCGACCACTAATGGGGAAGTTGGCA	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 270 aa

174-255

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 174-2551 model

				Actions
Predicted = Low	DIMER_P20719:174:255_2r5y_A_1	2r5y	174-255	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
196-252	PF00046	Homeodomain	overlaps 174-255