ModCRE DB

Transcription factor

P24278 - ZBTB25

Zinc finger and BTB domain-containing protein 25 (Zinc finger protein 46) (Zinc finger protein KUP)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 435 aa

8 Generated PWM 8 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)5
MotifPredictionSourceDNA bindingSupportLogoActions
M00775_2.00 NN 70-40% CisBP GTCCCGCAAC 53.6% identity Open · Scan
M00135_2.00 NN 70-40% CisBP AGCCCCCCAA 52.0% identity Open · Scan
MA0694.1 NN 70-40% JASPAR GCGACCACCGAA 52.0% identity Open · Scan
M08864_2.00 NN 70-40% CisBP CCTCCCCCCCCGCCCCCTCCCC 51.0% identity Open · Scan
M07706_2.00 NN 70-40% CisBP GTCTTTGAGAGGGCCCAGATGTTGGACTTA 50.0% identity Open · Scan
ModCRE3
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_P24278_ZBT25_HUMAN:193:270_2i13_A_1 ModCRE Homology model TTTTCTGTGTGTTTT Region 193-270 · 1 3D model Open · Scan
TFS_sp_P24278_ZBT25_HUMAN:344:390_2kmk_A_1 ModCRE Homology model TCGGGTATGGGCC Region 344-390 · 1 3D model Open · Scan
TFS_sp_P24278_ZBT25_HUMAN:347:383_5yj3_D_1 ModCRE Homology model CCCCCCCCGGGAC Region 347-383 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 435 aa
193-391

Region 193-391 3 PWM

Residues
199 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
8 active PDBs · 5 summary rows
Templates
2I13, 2KMK, 5T0U, 5YJ3, 7W1M, 8SSS, 8SST
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
8 active PDB models 5 summary rows
Region 193-3918 models · 5 summary rows
Actions
Predicted = Low TFS_sp_P24278_ZBT25_HUMAN:193:270_2i13_A_1 2i13 193-270 View model · PDB
Predicted = Low TFS_sp_P24278_ZBT25_HUMAN:238:391_5t0u_A_1 5t0u 238-391 View model · PDB
Predicted = Low TFS_sp_P24278_ZBT25_HUMAN:238:391_7w1m_H_1 7w1m 238-391 View model · PDB
Predicted = Low TFS_sp_P24278_ZBT25_HUMAN:238:391_8sss_A_1 8sss 238-391 View model · PDB
Predicted = Low TFS_sp_P24278_ZBT25_HUMAN:238:391_8sst_A_1 8sst 238-391 View model · PDB
Predicted = Low TFS_sp_P24278_ZBT25_HUMAN:344:390_2kmk_A_1 2kmk 344-390 View model · PDB
Predicted = Low TFS_sp_P24278_ZBT25_HUMAN:347:383_5yj3_C_1 5yj3 347-383 View model · PDB
Predicted = Low TFS_sp_P24278_ZBT25_HUMAN:347:383_5yj3_D_1 5yj3 347-383 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
5 5yj3 223:392 347 383 P:C · DNA:A,B 45.9% / 56.8% 51 View · PDB TFS_sp_P24278_ZBT25_HUMAN:347:383_5yj3_C_1
1 5t0u 223:392 238 391 P:A · DNA:B,C 23.4% / 40.5% 89 View · PDB TFS_sp_P24278_ZBT25_HUMAN:238:391_5t0u_A_1
2 8sss 223:392 238 391 P:A · DNA:B,C 23.4% / 40.5% 77 View · PDB TFS_sp_P24278_ZBT25_HUMAN:238:391_8sss_A_1
4 7w1m 223:392 238 391 P:H · DNA:F,G 23.4% / 40.5% 47 View · PDB TFS_sp_P24278_ZBT25_HUMAN:238:391_7w1m_H_1
3 8sst 223:392 238 391 P:A · DNA:B,C 23.4% / 39.9% 77 View · PDB TFS_sp_P24278_ZBT25_HUMAN:238:391_8sst_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
14-114PF00651BTB/POZ domainNo overlap with loaded model regions
240-260PF00096Zinc finger, C2H2 typeoverlaps 193-391
350-371PF00096Zinc finger, C2H2 typeoverlaps 193-391