ModCRE DB

Transcription factor

P25490 - YY1

Transcriptional repressor protein YY1 (Delta transcription factor) (INO80 complex subunit S) (NF-E1) (Yin and yang 1) (YY-1)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 414 aa

22 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known22
MotifPredictionSourceDNA bindingSupportLogoActions
MA0095.1 Known JASPAR GCCATC Direct PWM Open · Scan
MA0095.2 Known JASPAR CAAGATGGCGGC Direct PWM Open · Scan
M02877_2.00 Known CisBP GCCGCCATTAT Direct PWM Open · Scan
M04406_2.00 Known CisBP CGCCATCTTTGGCAATTCGTGCT Direct PWM Open · Scan
M04407_2.00 Known CisBP GGCCGCCATTTTGG Direct PWM Open · Scan
M04408_2.00 Known CisBP CGCCATTTTTGGCAATTTGTGCT Direct PWM Open · Scan
M04409_2.00 Known CisBP GGCGGCCATTTTGG Direct PWM Open · Scan
M05845_2.00 Known CisBP GGCCGCCATTTTG Direct PWM Open · Scan
M07855_2.00 Known CisBP GCGGCCGCCATCTTG Direct PWM Open · Scan
M07856_2.00 Known CisBP GCCGCCATCTT Direct PWM Open · Scan
M07857_2.00 Known CisBP GGCGGCCGCCATCTT Direct PWM Open · Scan
M07858_2.00 Known CisBP GGGGCCGCCATCTTG Direct PWM Open · Scan
M07859_2.00 Known CisBP GCCGCCGCCATCTTG Direct PWM Open · Scan
M07860_2.00 Known CisBP GCCGCCATCTTGGGT Direct PWM Open · Scan
M07861_2.00 Known CisBP CGCCGCCATCTTG Direct PWM Open · Scan
M08085_2.00 Known CisBP GCCGCCATCTTG Direct PWM Open · Scan
M08237_2.00 Known CisBP GGGGCCGCCATCTTG Direct PWM Open · Scan
M08288_2.00 Known CisBP GCCGCCATCTTG Direct PWM Open · Scan
M08865_2.00 Known CisBP GCCGCCATCTTG Direct PWM Open · Scan
M10138_2.00 Known CisBP GAACACCATTTTTGAAC Direct PWM Open · Scan
M10139_2.00 Known CisBP CCGCGGCCATCTTGGCTGCT Direct PWM Open · Scan
TYY1_HUMAN.H11MO.0.A Known HOCOMOCO CAAGATGGCGGC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 414 aa
295-408

Region 295-408 0 PWM

Residues
114 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
1UBD
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 295-4081 model
Actions
Predicted = Low TFS_P25490:295:408_1ubd_C_1 1ubd 295-408 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
298-320PF00096Zinc finger, C2H2 typeoverlaps 295-408
325-347PF00096Zinc finger, C2H2 typeoverlaps 295-408
353-377PF00096Zinc finger, C2H2 typeoverlaps 295-408
383-407PF00096Zinc finger, C2H2 typeoverlaps 295-408