Region 17-41 2 PWM
- Residues
- 25 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 2 active PDBs · 1 summary row
- Templates
- 2UZK, 5DUI
- Sources
- Predicted = Low
Transcription factor
P26651 - ZFP36
mRNA decay activator protein ZFP36 (G0/G1 switch regulatory protein 24) (Growth factor-inducible nuclear protein NUP475) (Tristetraprolin) (Zinc finger protein 36) (Zfp-36)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 326 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known0
No generated PWM in this category.
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M07313_2.00 | NN 70-40% | CisBP | CCGAAAAAATCGGAA | 54.5% identity | Open · Scan |
ModCRE2
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| DIMER_sp_P26651_TTP_HUMAN:17:41_5dui_A_1 | ModCRE | Homology model | GATCCCCCCCCGGAAAATCA | Region 17-41 · 1 3D model | Open · Scan | |
| TFS_sp_P26651_TTP_HUMAN:17:41_2uzk_A_1 | ModCRE | Homology model | GTTGTTAAATCCC | Region 17-41 · 1 3D model | Open · Scan |
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
326 aa
17-41
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
2 active PDB models
1 summary row
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 17-412 models · 1 summary row
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | DIMER_sp_P26651_TTP_HUMAN:17:41_5dui_A_1 | 5dui | 17-41 | View model · PDB |
| Predicted = Low | TFS_sp_P26651_TTP_HUMAN:17:41_2uzk_A_1 | 2uzk | 17-41 | View model · PDB |
Model-summary evidence imported for this region.
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 104-129 | PF00642 | Zinc finger C-x8-C-x5-C-x3-H type (and similar) | No overlap with loaded model regions |
| 142-168 | PF00642 | Zinc finger C-x8-C-x5-C-x3-H type (and similar) | No overlap with loaded model regions |