ModCRE DB

Transcription factor

P31629 - HIVEP2

Transcription factor HIVEP2 (Human immunodeficiency virus type I enhancer-binding protein 2) (HIV-EP2) (MHC-binding protein 2) (MBP-2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 2446 aa

20 Generated PWM 9 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)13
MotifPredictionSourceDNA bindingSupportLogoActions
M04590_2.00 NN 70-40% CisBP TGCGCTAACCATTGC 55.1% identity Open · Scan
M10303_2.00 NN 70-40% CisBP TACTGGGAATACC 51.8% identity Open · Scan
MA1508.1 NN 70-40% JASPAR GAAACAGGAAGT 51.8% identity Open · Scan
MA1655.1 NN 70-40% JASPAR GGGAACAGCCAC 51.0% identity Open · Scan
M08320_2.00 NN 70-40% CisBP TTCCCTGCC 50.9% identity Open · Scan
M08859_2.00 NN 70-40% CisBP CATTTTTTCCTCCTAGGCCT 50.9% identity Open · Scan
M00780_2.00 NN 70-40% CisBP GACCCCCCGG 50.0% identity Open · Scan
M01181_2.00 NN 70-40% CisBP GCGCATCCCC 50.0% identity Open · Scan
M07623_2.00 NN 70-40% CisBP GTCTAATAGAGCTGGGCTGCA 50.0% identity Open · Scan
M07625_2.00 NN 70-40% CisBP TCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 50.0% identity Open · Scan
M07757_2.00 NN 70-40% CisBP CCGCGGCC 50.0% identity Open · Scan
MA0751.1 NN 70-40% JASPAR GACCCCCCGCTGTGC 50.0% identity Open · Scan
MA1584.1 NN 70-40% JASPAR CGACCCCCCGCTGTGC 50.0% identity Open · Scan
ModCRE7
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_P31629_ZEP2_HUMAN:177:239_5egb_A_1 ModCRE Homology model ACGGAGAGCCCTGCAA Region 177-239 · 1 3D model Open · Scan
TFS_sp_P31629_ZEP2_HUMAN:177:239_5eh2_F_1 ModCRE Homology model CGGAGCGCCCGGTTA Region 177-239 · 1 3D model Open · Scan
TFS_sp_P31629_ZEP2_HUMAN:177:239_5ei9_E_1 ModCRE Homology model TAGGAGCTGCTGGTT Region 177-239 · 1 3D model Open · Scan
TFS_sp_P31629_ZEP2_HUMAN:1799:1847_4gzn_C_1 ModCRE Homology model AAAAGAGCCC Region 1799-1847 · 1 3D model Open · Scan
TFS_sp_P31629_ZEP2_HUMAN:1799:1847_4m9v_C_1 ModCRE Homology model AAAAAAGCCC Region 1799-1847 · 1 3D model Open · Scan
TFS_sp_P31629_ZEP2_HUMAN:189:239_6e93_A_1 ModCRE Homology model GCAACTGACGGTC Region 189-239 · 1 3D model Open · Scan
TFS_sp_P31629_ZEP2_HUMAN:189:239_6e94_A_1 ModCRE Homology model ACTACTGGAGTGC Region 189-239 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 2446 aa
177-239
1799-1847
1852-1865

Region 177-239 5 PWM

Residues
63 aa
Domains
PF00096 · Zinc finger, C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 5EGB, 5EH2, 5EI9, 6E93, 6E94
Sources
Predicted = Low
Scan this region Show models

Region 1799-1847 2 PWM

Residues
49 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
2 active PDBs
Templates
4GZN, 4M9V
Sources
Predicted = Low
Scan this region Show models

Region 1852-1865 0 PWM

Residues
14 aa
Domains
No overlapping PFAM annotation recorded
3D models
1 active PDB · 1 summary row
Templates
7XV8
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
9 active PDB models 7 summary rows
Region 177-2396 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_P31629_ZEP2_HUMAN:191:236_1llm_D_1 1llm 191-236 View model · PDB
Predicted = Low TFS_sp_P31629_ZEP2_HUMAN:177:239_5egb_A_1 5egb 177-239 View model · PDB
Predicted = Low TFS_sp_P31629_ZEP2_HUMAN:177:239_5eh2_F_1 5eh2 177-239 View model · PDB
Predicted = Low TFS_sp_P31629_ZEP2_HUMAN:177:239_5ei9_E_1 5ei9 177-239 View model · PDB
Predicted = Low TFS_sp_P31629_ZEP2_HUMAN:189:239_6e93_A_1 6e93 189-239 View model · PDB
Predicted = Low TFS_sp_P31629_ZEP2_HUMAN:189:239_6e94_A_1 6e94 189-239 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6e93 170:258 189 239 P:A · DNA:C,D 47.1% / 58.8% 45 View · PDB TFS_sp_P31629_ZEP2_HUMAN:189:239_6e93_A_1
2 6e94 170:258 189 239 P:A · DNA:C,D 45.1% / 58.8% 45 View · PDB TFS_sp_P31629_ZEP2_HUMAN:189:239_6e94_A_1
3 5ei9 170:258 177 239 P:E · DNA:A,B 44.4% / 61.9% 54 View · PDB TFS_sp_P31629_ZEP2_HUMAN:177:239_5ei9_E_1
4 5egb 170:258 177 239 P:A · DNA:C,D 44.4% / 61.9% 54 View · PDB TFS_sp_P31629_ZEP2_HUMAN:177:239_5egb_A_1
5 5eh2 170:258 177 239 P:F · DNA:C,D 44.4% / 61.9% 55 View · PDB TFS_sp_P31629_ZEP2_HUMAN:177:239_5eh2_F_1
1 1llm 170:258 191,191 236,236 P:C,D · DNA:A,B 39.1% / 52.2% 52,54 View · PDB DIMER_sp_P31629_ZEP2_HUMAN:191:236_1llm_D_1
Region 1799-18472 models
Actions
Predicted = Low TFS_sp_P31629_ZEP2_HUMAN:1799:1847_4gzn_C_1 4gzn 1799-1847 View model · PDB
Predicted = Low TFS_sp_P31629_ZEP2_HUMAN:1799:1847_4m9v_C_1 4m9v 1799-1847 View model · PDB
Region 1852-18651 model · 1 summary row
Actions
Predicted = Low DIMER_sp_P31629_ZEP2_HUMAN:1852:1865_7xv8_B_1 7xv8 1852-1865 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
2 7xv8 170:258 1852,1852 1865,1865 P:A,B · DNA:C,D 64.3% / 85.7% 18,18 View · PDB DIMER_sp_P31629_ZEP2_HUMAN:1852:1865_7xv8_B_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
189-211PF00096Zinc finger, C2H2 typeoverlaps 177-239
1799-1821PF00096Zinc finger, C2H2 typeoverlaps 1799-1847
1827-1851PF00096Zinc finger, C2H2 typeoverlaps 1799-1847