ModCRE DB

Transcription factor

P52739 - ZNF131

Zinc finger protein 131

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 623 aa

7 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M01447_2.00 NN 70-40% CisBP TACCCCTGA 51.5% identity Open · Scan
M01538_2.00 NN 70-40% CisBP GCCCCTGA 50.0% identity Open · Scan
ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_P52739_ZN131_HUMAN:323:439_6ml4_A_1 ModCRE Homology model GGGCCCCGACTCCCCGCGG Region 323-439 · 1 3D model Open · Scan
TFS_sp_P52739_ZN131_HUMAN:323:439_6ml5_A_1 ModCRE Homology model GGGCCCCGACTCCCACGGT Region 323-439 · 1 3D model Open · Scan
TFS_sp_P52739_ZN131_HUMAN:323:439_6ml6_A_1 ModCRE Homology model GGGCCCGGACTCCCACGGG Region 323-439 · 1 3D model Open · Scan
TFS_sp_P52739_ZN131_HUMAN:323:439_6ml7_A_1 ModCRE Homology model GGGCCACGACTCCCACGGG Region 323-439 · 1 3D model Open · Scan
TFS_sp_P52739_ZN131_HUMAN:330:439_8e3e_A_1 ModCRE Homology model TGATCAACTCAGTCTCACAA Region 330-439 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 623 aa
323-439

Region 323-439 5 PWM

Residues
117 aa
Domains
PF12874 · Zinc-finger of C2H2 type
3D models
6 active PDBs · 6 summary rows
Templates
1LLM, 6ML4, 6ML5, 6ML6, 6ML7, 8E3E
Sources
Predicted = Low
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 6 summary rows
Region 323-4396 models · 6 summary rows
Actions
Predicted = Low DIMER_sp_P52739_ZN131_HUMAN:330:374_1llm_C_1 1llm 330-374 View model · PDB
Predicted = Low TFS_sp_P52739_ZN131_HUMAN:323:439_6ml4_A_1 6ml4 323-439 View model · PDB
Predicted = Low TFS_sp_P52739_ZN131_HUMAN:323:439_6ml5_A_1 6ml5 323-439 View model · PDB
Predicted = Low TFS_sp_P52739_ZN131_HUMAN:323:439_6ml6_A_1 6ml6 323-439 View model · PDB
Predicted = Low TFS_sp_P52739_ZN131_HUMAN:323:439_6ml7_A_1 6ml7 323-439 View model · PDB
Predicted = Low TFS_sp_P52739_ZN131_HUMAN:330:439_8e3e_A_1 8e3e 330-439 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1llm 253:443 330,330 374,374 P:C,D · DNA:A,B 44.4% / 55.6% 51,52 View · PDB DIMER_sp_P52739_ZN131_HUMAN:330:374_1llm_C_1
5 8e3e 253:443 330 439 P:A · DNA:X,Y 38.2% / 49.1% 91 View · PDB TFS_sp_P52739_ZN131_HUMAN:330:439_8e3e_A_1
1 6ml5 253:443 323 439 P:A · DNA:E,F 35.9% / 50.4% 76 View · PDB TFS_sp_P52739_ZN131_HUMAN:323:439_6ml5_A_1
2 6ml7 253:443 323 439 P:A · DNA:E,F 35.9% / 50.4% 76 View · PDB TFS_sp_P52739_ZN131_HUMAN:323:439_6ml7_A_1
3 6ml6 253:443 323 439 P:A · DNA:E,F 35.9% / 50.4% 76 View · PDB TFS_sp_P52739_ZN131_HUMAN:323:439_6ml6_A_1
4 6ml4 253:443 323 439 P:A · DNA:E,F 35.9% / 50.4% 76 View · PDB TFS_sp_P52739_ZN131_HUMAN:323:439_6ml4_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
24-126PF00651BTB/POZ domainNo overlap with loaded model regions
288-308PF12874Zinc-finger of C2H2 typeNo overlap with loaded model regions
392-411PF12874Zinc-finger of C2H2 typeoverlaps 323-439