Transcription factor

P52746 - ZNF142

Zinc finger protein 142

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1687 aa

2 Generated PWM 11 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
TFS_sp_P52746_ZN142_HUMAN:1169:1309_5yef_A_1	ModCRE	Homology model	AAAAACAGCTAAAGAAGCGAACCTT	Region 1169-1309 · 1 3D model		Open · Scan
TFS_sp_P52746_ZN142_HUMAN:1172:1304_5und_A_1	ModCRE	Homology model	AAACTGCTAAAGCAATTTT	Region 1172-1304 · 1 3D model		Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 1687 aa

1169-1374

1420-1656

Residues: 206 aa
Domains: PF23612 · ZN142 C2H2 zinc finger PF23611 · C2H2 zinc finger PF23612 · ZN142 C2H2 zinc finger PF13912 · C2H2-type zinc finger
3D models: 5 active PDBs
Templates: 5UND, 5YEF
Sources: Predicted = Low

Scan this region Show models

Residues: 237 aa
Domains: PF23611 · C2H2 zinc finger PF23611 · C2H2 zinc finger PF23611 · C2H2 zinc finger PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

11 active PDB models 6 summary rows

Region 1169-13745 models

Region 1420-16566 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
3	2i13	1420:1656	1439	1587	P:A · DNA:C,D	40.3% / 53.7%	96	View · PDB TFS_sp_P52746_ZN142_HUMAN:1439:1587_2i13_A_1
2	5wjq	1420:1656	1420	1643	P:D · DNA:A,B	33.5% / 44.2%	79	View · PDB TFS_sp_P52746_ZN142_HUMAN:1420:1643_5wjq_D_1
1	7w1m	1420:1656	1423	1643	P:H · DNA:F,G	33.3% / 47.6%	68	View · PDB TFS_sp_P52746_ZN142_HUMAN:1423:1643_7w1m_H_1
1	1llm	1420:1656	1563,1563	1611,1611	P:C,D · DNA:A,B	32.7% / 51.0%	56,57	View · PDB DIMER_sp_P52746_ZN142_HUMAN:1563:1611_1llm_C_1
4	5v3m	1420:1656	1423	1656	P:C · DNA:A,B	30.3% / 46.6%	84	View · PDB TFS_sp_P52746_ZN142_HUMAN:1423:1656_5v3m_C_1
5	5v3j	1420:1656	1423	1656	P:E · DNA:A,B	30.3% / 46.6%	84	View · PDB TFS_sp_P52746_ZN142_HUMAN:1423:1656_5v3j_E_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
192-211	PF00096	Zinc finger, C2H2 type	No overlap with loaded model regions
253-276	PF13912	C2H2-type zinc finger	No overlap with loaded model regions
571-605	PF23574	Zinc finger protein 142 C2H2 domain	No overlap with loaded model regions
1104-1127	PF27528	ZNF142, C2H2-type zinc finger	No overlap with loaded model regions
1171-1197	PF23612	ZN142 C2H2 zinc finger	overlaps 1169-1374
1200-1224	PF23611	C2H2 zinc finger	overlaps 1169-1374
1228-1254	PF23612	ZN142 C2H2 zinc finger	overlaps 1169-1374
1285-1311	PF13912	C2H2-type zinc finger	overlaps 1169-1374
1424-1449	PF23611	C2H2 zinc finger	overlaps 1420-1656
1452-1477	PF23611	C2H2 zinc finger	overlaps 1420-1656
1480-1505	PF23611	C2H2 zinc finger	overlaps 1420-1656
1536-1559	PF00096	Zinc finger, C2H2 type	overlaps 1420-1656
1565-1587	PF00096	Zinc finger, C2H2 type	overlaps 1420-1656