Transcription factor

P57082 - TBX4

T-box transcription factor TBX4 (T-box protein 4)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 545 aa

3 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known3

Motif	Prediction	Source	DNA binding	Support	Actions
MA0806.1	Known	JASPAR	AGGTGTGA	Direct PWM	Open · Scan
M03558_2.00	Known	CisBP	AGGTGTGA	Direct PWM	Open · Scan
M03559_2.00	Known	CisBP	AGGTGTGAAATTTCACACCT	Direct PWM	Open · Scan

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 545 aa

67-249

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

1 active PDB model

Region 67-2491 model

				Actions
Predicted = Low	TFS_P57082:67:249_6f59_B_1	6f59	67-249	View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
70-250	PF00907	T-box	overlaps 67-249