Region 336-471 0 PWM
- Residues
- 136 aa
- Domains
- No overlapping PFAM annotation recorded
- 3D models
- 1 active PDB
- Templates
- 5V3J
- Sources
- Structure model
Transcription factor
P59817 - ZNF280A
Zinc finger protein 280A (3'OY11.1) (Suppressor of hairy wing homolog 1) (Zinc finger protein 636)
Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 542 aa
Motif Prediction
Only entries with a generated matrix are shown here.
Known1
| Motif | Prediction | Source | DNA binding | Support | Logo | Actions |
|---|---|---|---|---|---|---|
| M08332_2.00 | Known | CisBP | TCTCTCCAGTGTGAATTCTCTGAT | Direct PWM | Open · Scan |
Nearest Neighbor (>70%)0
No generated PWM in this category.
Nearest Neighbor (70% - 40%)0
No generated PWM in this category.
ModCRE0
No generated PWM in this category.
Model-supported DNA-binding regions
Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.
1
542 aa
336-471
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
Region 336-4711 model
| Actions | ||||
|---|---|---|---|---|
| Predicted = Low | TFS_P59817:336:471_5v3j_E_1 | 5v3j | 336-471 | View model · PDB |
View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.
Domains
Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.
| Residues | PFAM | Domain | Used by prediction region? |
|---|---|---|---|
| 47-217 | PF13836 | Domain of unknown function (DUF4195) | No overlap with loaded model regions |