Transcription factor

P62380 - TBPL1

TATA box-binding protein-like 1 (TBP-like 1) (21 kDa TBP-like protein) (Second TBP of unique DNA protein) (STUD) (TATA box-binding protein-related factor 2) (TBP-related factor 2) (TBP-like factor) (TBP-related protein)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 186 aa

1 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE1

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
TFS_sp_P62380_TBPL1_HUMAN:13:183_6f40_U_1	ModCRE	Homology model	TCTGACCTTTTAAAATTTTA	Region 13-183 · 1 3D model		Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 186 aa

13-183

Region 13-183 1 PWM

Residues: 171 aa
Domains: PF00352 · Transcription factor TFIID (or TATA-binding protein, TBP) PF00352 · Transcription factor TFIID (or TATA-binding protein, TBP)
3D models: 6 active PDBs · 5 summary rows
Templates: 6F40, 7EDX, 7EGD, 7EGJ, 7ZWC, 7ZXE
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 5 summary rows

Region 13-1836 models · 5 summary rows

				Actions
Predicted = Low	TFS_sp_P62380_TBPL1_HUMAN:13:183_6f40_U_1	6f40	13-183	View model · PDB
Predicted = Low	TFS_sp_P62380_TBPL1_HUMAN:13:183_7edx_P_1	7edx	13-183	View model · PDB
Predicted = Low	TFS_sp_P62380_TBPL1_HUMAN:13:183_7egd_P_1	7egd	13-183	View model · PDB
Predicted = Low	TFS_sp_P62380_TBPL1_HUMAN:13:183_7egj_P_1	7egj	13-183	View model · PDB
Predicted = Low	TFS_sp_P62380_TBPL1_HUMAN:13:183_7zwc_O_1	7zwc	13-183	View model · PDB
Predicted = Low	TFS_sp_P62380_TBPL1_HUMAN:13:183_7zxe_O_1	7zxe	13-183	View model · PDB

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	7egj	13:183	13	183	P:P · DNA:X,Y	42.2% / 61.3%	96	View · PDB TFS_sp_P62380_TBPL1_HUMAN:13:183_7egj_P_1
2	7egd	13:183	13	183	P:P · DNA:X,Y	42.2% / 61.3%	96	View · PDB TFS_sp_P62380_TBPL1_HUMAN:13:183_7egd_P_1
3	7edx	13:183	13	183	P:P · DNA:X,Y	42.2% / 61.3%	96	View · PDB TFS_sp_P62380_TBPL1_HUMAN:13:183_7edx_P_1
4	7zxe	13:183	13	183	P:O · DNA:N,T	42.2% / 61.3%	95	View · PDB TFS_sp_P62380_TBPL1_HUMAN:13:183_7zxe_O_1
5	7zwc	13:183	13	183	P:O · DNA:N,T	42.2% / 61.3%	95	View · PDB TFS_sp_P62380_TBPL1_HUMAN:13:183_7zwc_O_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
11-91	PF00352	Transcription factor TFIID (or TATA-binding protein, TBP)	overlaps 13-183
99-178	PF00352	Transcription factor TFIID (or TATA-binding protein, TBP)	overlaps 13-183