ModCRE DB

Transcription factor

P82094 - TMF1

TATA element modulatory factor (TMF) (Androgen receptor coactivator 160 kDa protein) (Androgen receptor-associated protein of 160 kDa)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 1093 aa

4 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE4
MotifPredictionSourceDNA bindingSupportLogoActions
p82094.af3.0 ModCRE AlphaFold3 model CAGGGGTTGGTGCCGGCGCGCCCCCC AlphaFold3 model · ModCRE PWM Open · Scan
p82094.af3.1 ModCRE AlphaFold3 model GCGGGGCCACCGGGCT AlphaFold3 model · ModCRE PWM Open · Scan
p82094.af3.2 ModCRE AlphaFold3 model CAGGGGTTGGTGCCGGCGCGCCCCCC AlphaFold3 model · ModCRE PWM Open · Scan
p82094.af3.5 ModCRE AlphaFold3 model AAC AlphaFold3 model · ModCRE PWM Open · Scan
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models
SourceModelTemplateResidues modeledActions
Predicted = Lowp82094.af3.0-Full sequenceView model · PDB
Predicted = Lowp82094.af3.1-Full sequenceView model · PDB
Predicted = Lowp82094.af3.2-Full sequenceView model · PDB
Predicted = Lowp82094.af3.3-Full sequenceView model · PDB
Predicted = Lowp82094.af3.4-Full sequenceView model · PDB
Predicted = Lowp82094.af3.5-Full sequenceView model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomain
543-615PF12329TATA element modulatory factor 1 DNA binding
977-1087PF12325TATA element modulatory factor 1 TATA binding