ModCRE DB

Transcription factor

Q00059 - TFAM

Transcription factor A, mitochondrial (mtTFA) (Mitochondrial transcription factor 1) (MtTF1) (Transcription factor 6) (TCF-6) (Transcription factor 6-like 2)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 246 aa

3 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE3
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q00059_TFAM_HUMAN:43:237_3tmm_A_1 ModCRE Homology model ACCTTTAAGAGTGGGCCTCCAACAACAG Region 43-237 · 1 3D model Open · Scan
TFS_sp_Q00059_TFAM_HUMAN:44:237_3tq6_A_1 ModCRE Homology model ACTTGTTGGGGGGCTACACTTA Region 44-237 · 1 3D model Open · Scan
TFS_sp_Q00059_TFAM_HUMAN:44:240_6hb4_A_1 ModCRE Homology model TAATAATTGGATGTCTGCACAG Region 44-240 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 246 aa
43-240

Region 43-240 3 PWM

Residues
198 aa
Domains
PF00505 · HMG (high mobility group) box PF09011 · HMG-box domain
3D models
6 active PDBs · 5 summary rows
Templates
3TMM, 3TQ6, 4NNU, 6HB4, 7LBW
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
6 active PDB models 5 summary rows
Region 43-2406 models · 5 summary rows
Actions
Predicted = Low TFS_sp_Q00059_TFAM_HUMAN:43:237_3tmm_A_1 3tmm 43-237 View model · PDB
Predicted = Low TFS_sp_Q00059_TFAM_HUMAN:44:235_4nnu_B_1 4nnu 44-235 View model · PDB
Predicted = Low TFS_sp_Q00059_TFAM_HUMAN:44:236_4nnu_A_1 4nnu 44-236 View model · PDB
Predicted = Low TFS_sp_Q00059_TFAM_HUMAN:44:236_7lbw_A_1 7lbw 44-236 View model · PDB
Predicted = Low TFS_sp_Q00059_TFAM_HUMAN:44:237_3tq6_A_1 3tq6 44-237 View model · PDB
Predicted = Low TFS_sp_Q00059_TFAM_HUMAN:44:240_6hb4_A_1 6hb4 44-240 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 6hb4 43:240 44 240 P:A · DNA:B,C 100.0% / 100.0% 100 View · PDB TFS_sp_Q00059_TFAM_HUMAN:44:240_6hb4_A_1
2 3tmm 43:240 43 237 P:A · DNA:B,C 100.0% / 100.0% 100 View · PDB TFS_sp_Q00059_TFAM_HUMAN:43:237_3tmm_A_1
3 3tq6 43:240 44 237 P:A · DNA:C,D 100.0% / 100.0% 100 View · PDB TFS_sp_Q00059_TFAM_HUMAN:44:237_3tq6_A_1
4 7lbw 43:240 44 236 P:A · DNA:C,D,E,F 100.0% / 100.0% 100 View · PDB TFS_sp_Q00059_TFAM_HUMAN:44:236_7lbw_A_1
5 4nnu 43:240 44 236 P:A · DNA:C,D,E,F 100.0% / 100.0% 100 View · PDB TFS_sp_Q00059_TFAM_HUMAN:44:236_4nnu_A_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
50-118PF00505HMG (high mobility group) boxoverlaps 43-240
154-219PF09011HMG-box domainoverlaps 43-240