ModCRE DB

Transcription factor

Q01658 - DR1

Protein Dr1 (Down-regulator of transcription 1) (Negative cofactor 2-beta) (NC2-beta) (TATA-binding protein-associated phosphoprotein)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 176 aa

5 Generated PWM 5 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE5
MotifPredictionSourceDNA bindingSupportLogoActions
TFS_sp_Q01658_NC2B_HUMAN:10:93_7cvo_B_1 ModCRE Homology model ATAGAACTTCTTATACCGTAATCA Region 10-93 · 1 3D model Open · Scan
TFS_sp_Q01658_NC2B_HUMAN:13:132_4wzs_B_1 ModCRE Homology model AGGCCTTAAATAGGGGATA Region 13-132 · 1 3D model Open · Scan
TFS_sp_Q01658_NC2B_HUMAN:5:92_6r2v_B_1 ModCRE Homology model CAAAGGCAACCGGTAAACGTTTT Region 5-92 · 1 3D model Open · Scan
TFS_sp_Q01658_NC2B_HUMAN:8:93_4awl_B_1 ModCRE Homology model TATAGCGCAAGGCGGTAAATTAGGT Region 8-93 · 1 3D model Open · Scan
TFS_sp_Q01658_NC2B_HUMAN:9:143_1jfi_B_1 ModCRE Homology model GGGCTAAAAATAACCTT Region 9-143 · 1 3D model Open · Scan

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 176 aa
5-143

Region 5-143 5 PWM

Residues
139 aa
Domains
PF00808 · Histone-like transcription factor (CBF/NF-Y) and archaeal histone
3D models
5 active PDBs · 5 summary rows
Templates
1JFI, 4AWL, 4WZS, 6R2V, 7CVO
Sources
Predicted = Low
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
5 active PDB models 5 summary rows
Region 5-1435 models · 5 summary rows
Actions
Predicted = Low TFS_sp_Q01658_NC2B_HUMAN:10:93_7cvo_B_1 7cvo 10-93 View model · PDB
Predicted = Low TFS_sp_Q01658_NC2B_HUMAN:13:132_4wzs_B_1 4wzs 13-132 View model · PDB
Predicted = Low TFS_sp_Q01658_NC2B_HUMAN:5:92_6r2v_B_1 6r2v 5-92 View model · PDB
Predicted = Low TFS_sp_Q01658_NC2B_HUMAN:8:93_4awl_B_1 4awl 8-93 View model · PDB
Predicted = Low TFS_sp_Q01658_NC2B_HUMAN:9:143_1jfi_B_1 1jfi 9-143 View model · PDB

Model-summary evidence imported for this region.

RankTemplateDomainN-tailsC-tailsChainsIdentity / similarityCoverageModel file
1 1jfi 5:143 9 143 P:B · DNA:D,E 100.0% / 100.0% 100 View · PDB TFS_sp_Q01658_NC2B_HUMAN:9:143_1jfi_B_1
2 4awl 5:143 8 93 P:B · DNA:I,J 37.9% / 67.8% 93 View · PDB TFS_sp_Q01658_NC2B_HUMAN:8:93_4awl_B_1
4 7cvo 5:143 10 93 P:B · DNA:D,E 35.3% / 67.1% 95 View · PDB TFS_sp_Q01658_NC2B_HUMAN:10:93_7cvo_B_1
5 6r2v 5:143 5 92 P:B · DNA:I,J 33.7% / 65.2% 94 View · PDB TFS_sp_Q01658_NC2B_HUMAN:5:92_6r2v_B_1
3 4wzs 5:143 13 132 P:B · DNA:E,F 31.4% / 57.0% 94 View · PDB TFS_sp_Q01658_NC2B_HUMAN:13:132_4wzs_B_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
12-75PF00808Histone-like transcription factor (CBF/NF-Y) and archaeal histoneoverlaps 5-143