ModCRE DB

Transcription factor

Q06730 - ZNF33A

Zinc finger protein 33A (Zinc finger and ZAK-associated protein with KRAB domain) (ZZaPK) (Zinc finger protein 11A) (Zinc finger protein KOX31)

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 810 aa

3 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known3
MotifPredictionSourceDNA bindingSupportLogoActions
M08263_2.00 Known CisBP ATCTCGGCACTTTGGGAGGCCA Direct PWM Open · Scan
M07695_2.00 Known CisBP GTGGCT Direct PWM Open · Scan
M08369_2.00 Known CisBP TCAGTGCAC Direct PWM Open · Scan
Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)0

No generated PWM in this category.

ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 810 aa
329-488

Region 329-488 0 PWM

Residues
160 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
5T0U
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 329-4881 model
Actions
Predicted = Low TFS_Q06730:329:488_5t0u_A_1 5t0u 329-488 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
11-52PF01352KRAB boxNo overlap with loaded model regions
328-350PF00096Zinc finger, C2H2 typeoverlaps 329-488
356-378PF00096Zinc finger, C2H2 typeoverlaps 329-488
384-406PF00096Zinc finger, C2H2 typeoverlaps 329-488
412-434PF00096Zinc finger, C2H2 typeoverlaps 329-488
440-462PF00096Zinc finger, C2H2 typeoverlaps 329-488
468-490PF00096Zinc finger, C2H2 typeoverlaps 329-488
496-518PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
524-546PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
552-574PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
580-602PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
608-630PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
636-658PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
664-686PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
692-714PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
721-742PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
748-770PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions