Transcription factor

Q0VAH5 - ZNF366

Zinc finger protein 366 (Dendritic cell-specific transcript protein)

Homo sapiens (Human) · Unreviewed (UniProtKB/TrEMBL) · 744 aa

7 Generated PWM 6 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)0

No generated PWM in this category.

Nearest Neighbor (70% - 40%)2

Motif	Prediction	Source	DNA binding	Support	Logo	Actions
M00224_2.00	NN 70-40%	CisBP	CCCGCCCC	50.0% identity		Open · Scan
M09008_2.00	NN 70-40%	CisBP	CCCGGCCCCACCCT	50.0% identity		Open · Scan

ModCRE5

Motif	Prediction	Source	DNA binding	Support	Actions
DIMER_tr_Q0VAH5_Q0VAH5_HUMAN:502:556_1llm_C_1	ModCRE	Homology model	CCCGCGCGCGGC	Region 502-556 · 1 3D model	Open · Scan
TFS_tr_Q0VAH5_Q0VAH5_HUMAN:279:554_5wjq_D_1	ModCRE	Homology model	CCCAGGGGCTGCATAGTTTGCAGGGCCC	Region 279-554 · 1 3D model	Open · Scan
TFS_tr_Q0VAH5_Q0VAH5_HUMAN:280:554_5v3j_E_1	ModCRE	Homology model	TCTGGAGGGGAAAAACCGGGGGCTCC	Region 280-554 · 1 3D model	Open · Scan
TFS_tr_Q0VAH5_Q0VAH5_HUMAN:280:554_5v3m_C_1	ModCRE	Homology model	ATGTGACAGTTGGTGCACATGGGCCG	Region 280-554 · 1 3D model	Open · Scan
TFS_tr_Q0VAH5_Q0VAH5_HUMAN:290:443_2i13_A_1	ModCRE	Homology model	TCAATGCTGAAGCCTAAAATT	Region 290-443 · 1 3D model	Open · Scan

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 744 aa

253-556

Residues: 304 aa
Domains: PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF13912 · C2H2-type zinc finger PF00096 · Zinc finger, C2H2 type
3D models: 6 active PDBs · 6 summary rows
Templates: 1LLM, 2I13, 5V3J, 5V3M, 5WJQ, 7W1M
Sources: Predicted = Low

Scan this region Show models

3D Models

Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.

6 active PDB models 6 summary rows

Region 253-5566 models · 6 summary rows

Model-summary evidence imported for this region.

Rank	Template	Domain	N-tails	C-tails	Chains	Identity / similarity	Coverage	Model file
1	5v3m	248:557	280	554	P:C · DNA:A,B	38.5% / 49.8%	99	View · PDB TFS_tr_Q0VAH5_Q0VAH5_HUMAN:280:554_5v3m_C_1
2	5v3j	248:557	280	554	P:E · DNA:A,B	38.5% / 49.8%	99	View · PDB TFS_tr_Q0VAH5_Q0VAH5_HUMAN:280:554_5v3j_E_1
5	2i13	248:557	290	443	P:A · DNA:C,D	37.7% / 48.7%	100	View · PDB TFS_tr_Q0VAH5_Q0VAH5_HUMAN:290:443_2i13_A_1
3	5wjq	248:557	279	554	P:D · DNA:A,B	37.0% / 50.4%	98	View · PDB TFS_tr_Q0VAH5_Q0VAH5_HUMAN:279:554_5wjq_D_1
1	1llm	248:557	502,502	556,556	P:C,D · DNA:A,B	36.4% / 56.4%	63,64	View · PDB DIMER_tr_Q0VAH5_Q0VAH5_HUMAN:502:556_1llm_C_1
4	7w1m	248:557	253	551	P:H · DNA:F,G	29.2% / 43.8%	92	View · PDB TFS_tr_Q0VAH5_Q0VAH5_HUMAN:253:551_7w1m_H_1

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

Residues	PFAM	Domain	Used by prediction region?
254-275	PF00096	Zinc finger, C2H2 type	overlaps 253-556
281-303	PF00096	Zinc finger, C2H2 type	overlaps 253-556
309-331	PF00096	Zinc finger, C2H2 type	overlaps 253-556
337-359	PF00096	Zinc finger, C2H2 type	overlaps 253-556
367-387	PF00096	Zinc finger, C2H2 type	overlaps 253-556
393-415	PF00096	Zinc finger, C2H2 type	overlaps 253-556
421-443	PF00096	Zinc finger, C2H2 type	overlaps 253-556
449-471	PF00096	Zinc finger, C2H2 type	overlaps 253-556
477-499	PF00096	Zinc finger, C2H2 type	overlaps 253-556
505-527	PF13912	C2H2-type zinc finger	overlaps 253-556
533-556	PF00096	Zinc finger, C2H2 type	overlaps 253-556