ModCRE DB

Transcription factor

Q12901 - ZNF155

Zinc finger protein 155

Homo sapiens (Human) · Reviewed (UniProtKB/Swiss-Prot) · 538 aa

35 Generated PWM 1 3D models

Motif Prediction

Only entries with a generated matrix are shown here.

Known0

No generated PWM in this category.

Nearest Neighbor (>70%)2
MotifPredictionSourceDNA bindingSupportLogoActions
M08399_2.00 NN 70+% CisBP TACTCTGGGGCCACATGACTC 76.5% identity Open · Scan
M07654_2.00 NN 70+% CisBP TGCCCCCTGGTGGC 70.8% identity Open · Scan
Nearest Neighbor (70% - 40%)33
MotifPredictionSourceDNA bindingSupportLogoActions
M07679_2.00 NN 70-40% CisBP TGCGATCTC 65.7% identity Open · Scan
M00952_2.00 NN 70-40% CisBP GGATGCTC 63.5% identity Open · Scan
M00953_2.00 NN 70-40% CisBP ATCTATAT 63.5% identity Open · Scan
M00955_2.00 NN 70-40% CisBP ACGTCCTCT 63.5% identity Open · Scan
M00960_2.00 NN 70-40% CisBP TGCATCCC 63.5% identity Open · Scan
M00948_2.00 NN 70-40% CisBP GCAGCACC 61.1% identity Open · Scan
M00950_2.00 NN 70-40% CisBP GCAGCCCA 61.1% identity Open · Scan
M00959_2.00 NN 70-40% CisBP GCCCTCCC 61.1% identity Open · Scan
M00943_2.00 NN 70-40% CisBP CCCGCTGC 58.8% identity Open · Scan
M00944_2.00 NN 70-40% CisBP TCGCTATAA 58.8% identity Open · Scan
M00958_2.00 NN 70-40% CisBP CGGCATCCC 58.8% identity Open · Scan
M01456_2.00 NN 70-40% CisBP GTGATCGGCG 56.5% identity Open · Scan
M04650_2.00 NN 70-40% CisBP GCATAACTGCCCCGCTGCC 56.1% identity Open · Scan
MA1124.1 NN 70-40% JASPAR CATTCATTCATTC 56.0% identity Open · Scan
M04387_2.00 NN 70-40% CisBP CGTGCTCCCC 55.8% identity Open · Scan
M01474_2.00 NN 70-40% CisBP CGCCGATCAC 55.1% identity Open · Scan
M08901_2.00 NN 70-40% CisBP CCAGTTCACACC 55.0% identity Open · Scan
M00939_2.00 NN 70-40% CisBP CCACCTCA 54.1% identity Open · Scan
M00645_2.00 NN 70-40% CisBP CGCCCACGCA 53.2% identity Open · Scan
M02924_2.00 NN 70-40% CisBP AGTGTTAACAGAACACCT 52.8% identity Open · Scan
M00945_2.00 NN 70-40% CisBP CACCGCAC 51.7% identity Open · Scan
M08254_2.00 NN 70-40% CisBP CTGCCCTGGGACTTT 51.7% identity Open · Scan
M00786_2.00 NN 70-40% CisBP TATATATAT 51.3% identity Open · Scan
M04598_2.00 NN 70-40% CisBP CGCTAACTCTCCACA 51.3% identity Open · Scan
M07683_2.00 NN 70-40% CisBP GTGGGAAAGCCT 51.3% identity Open · Scan
MA1601.1 NN 70-40% JASPAR ATGTGGGAAA 51.3% identity Open · Scan
M07649_2.00 NN 70-40% CisBP CCCCCCCCCCCCTCAGGAATGCC 50.8% identity Open · Scan
M04505_2.00 NN 70-40% CisBP AGCTTTTCCCACAC 50.6% identity Open · Scan
M04536_2.00 NN 70-40% CisBP ACGTAACCCGATACC 50.2% identity Open · Scan
M00782_2.00 NN 70-40% CisBP AGTGTGCGCTA 50.0% identity Open · Scan
M04613_2.00 NN 70-40% CisBP CTCATGTGCTAATTACAAA 50.0% identity Open · Scan
M06179_2.00 NN 70-40% CisBP TAAGCCTATAGA 50.0% identity Open · Scan
M08329_2.00 NN 70-40% CisBP GCTGCATAGTATTCC 50.0% identity Open · Scan
ModCRE0

No generated PWM in this category.

Model-supported DNA-binding regions

Protein residue intervals where structure models support predicted PWMs. Domain annotations and modeled regions are shown together when available.

1 538 aa
204-313

Region 204-313 0 PWM

Residues
110 aa
Domains
PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type PF00096 · Zinc finger, C2H2 type
3D models
1 active PDB
Templates
6E93
Sources
Structure model
Scan this region Show models
3D Models
Collapsible technical table. Rows are grouped by protein region and retain model, template, residue coverage, and available summary evidence.
1 active PDB model
Region 204-3131 model
Actions
Predicted = Low TFS_Q12901:204:313_6e93_A_1 6e93 204-313 View model · PDB

View full model evidence table for rank, chains, N/C tails, coverage, RMSD-template information, identity/similarity, and linked model files.

Domains

Annotated protein domains. Overlaps with model-supported DNA-binding regions are shown when available.

ResiduesPFAMDomainUsed by prediction region?
8-48PF01352KRAB boxNo overlap with loaded model regions
176-198PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
204-226PF00096Zinc finger, C2H2 typeoverlaps 204-313
232-254PF00096Zinc finger, C2H2 typeoverlaps 204-313
260-282PF00096Zinc finger, C2H2 typeoverlaps 204-313
288-310PF00096Zinc finger, C2H2 typeoverlaps 204-313
372-394PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
400-422PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
428-450PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions
456-478PF00096Zinc finger, C2H2 typeNo overlap with loaded model regions